Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_K10D2.2   

sjj_K10D2.2RNAiJA:K10D2.2
PCR_productsjj_K10D2.2
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene K10D2.2 Source_evidenceePCR1008WS150 Sequence/Annotation Release
Chunk_score Abs_score924
Max_abs_score924K10D2.2
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII51860685187261
Overlaps_transcript K10D2.2.2 Source_evidenceePCR1008WS150 Sequence/Annotation Release
K10D2.2.1 Source_evidenceePCR1008WS150 Sequence/Annotation Release
WB_DNA_textsjj_K10D2.21194acaacatcagattgcaccgaaagacgtcactcatcgagttcaccttgcaaaatgagtcaaaacggaagcagtggatactatgaaggagatgttttactggatgatgatgctcttgtttcgatgccagaagcaacgctcattgagtgctttggtaatctggctgtcacaaaaagacctgcacatctgagacctccggcagctttctgtacgttttttccgttatacgaagaaaatttaatatcttttaaaaaaataataatcacaaattggaattttacaggtctaccgtttgtatcaatgaacaacgatttgacgagcggacatgccttgaaacatatcacattgacgttagttttcgagttaattttacttttatttaaaaaaaaaacatttttagatcagtattcgacgcactacatccgtacgttgccatgccgtacatcaacagaatggatatatgctctgcaatgaacgtatattggatcagaaactgtttggaagctgaacaatccgatttatttcatcgattcgctctggaaatgcaagtacatttgagtgcatgttttggatgtcgcgttgtcctggatatctatggatcaaccagaaacggattcggtacccgattctgtgatgttgatatgtcactttctttttcaccgagtccaccttcatgggcaaccaattcggatcgagtgatgagagctgttgcgaaggcacttgtcgattttccgaaagcagttgatgagagatatgtcaacgccaaagttccaattgtcagattcagaagcagtgacatggatatggaagcagagtaagtttttataaaatcttgatcttgtcagaactttaaattaaaattctaattatttcagcatcagttacaagaatgatttggctcttcacaatactcagcttttgcaacaatactgcaaatgggatcccgaaagactaccgactcttggagtttgggtcaaagcgtgggcgaaacgaagtggagttggagatgcatcaaaaggatcgctgtcttcatatgcttggattgtgatgcttattcattatcttcagcaagtcgaaccaattcctgtgttgccatgtcttcaggaaatgaaccatcagaaaagtgaaaatgtctacgtccaaggttacaacacgtattattggaaattcgtagacactgctcgtacacgacgttgt