Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_K12B6.8   

sjj_K12B6.8 RNAi (5)
PCR_productsjj_K12B6.8
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSK12B6.8 Source_evidenceePCR779WS150 Sequence/Annotation Release
Overlaps_Gene K12B6.8 Source_evidenceePCR779WS150 Sequence/Annotation Release
Chunk_score Abs_score695
Max_abs_score695K12B6.8
Specificity_index1
Rel_score1
Map_statusUnique_ePCRV63124356313564
Overlaps_transcriptK12B6.8 Source_evidenceePCR779WS150 Sequence/Annotation Release
WB_DNA_textsjj_K12B6.81130aattcgccacgtatttccagacgtaccttaggatatccattgaacactgcaagcatcagacagatctctactgcatcgtacatatcacaggttctaagagttcttttcatcttctcggcgaccacctttttgtaagcaatttctgcgtagttgcggatgttccggaatcccagcaagcctaggtattcgatctcggcgcgaacgtcttcatttgtgaacccttttggagcaacgtctcggatcgtttttgtggtttccggttttgcgaaagctgttgaaaatgtcgaatctacactgtcaatcactgattcttcgaggaagtagatgccttgctgaaaaagaactcatggataaaattagaaatcataaacttacagcatatggcttgaaaatcttaacgagagaatccatataattatccaagaatggcatggtttctttgtttggtgactgaaacgccagcgagccaaaaaacatgtctctgagatgctccaagagcacatcggatgaaagtttgcaaaactttccgttcgacaagcggaccggtacggcggtgtgcttcgtgcgtcggatggatgatttaacacactgaaataatttttctttaatttttctgtcaattatgccaaatgctgggttcttacataaaaattattcagcaatcttcccgtgctcgccataatcatgtcgacatcagcaaagtccatggtctcgacacaatttttcattaatgaaggatttgcgacctccaccttgtattccatggctttctcaagttcatgtactatgacgaatacttgttctccgtcatcgaaaactcgaaatgttggtcttgctcttttgatctgaaagttgataaactagaagctatagaaattaatgtaggtttttcgtctacatggtctgaattacaaccatattctagttattatgttttttgtaaaatcagaaagaaagatttacgacgccaattgtttctggttctgcggcccattacatactcatacgatgaaagtaacgtaagtgaccaatctcagaaaatgttggggatcggtagatattcaaactcacttgatccggtaaaaaccattttggtcgcttagacataatcttttgaagtccgggaatca