Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_K12C11.1   

sjj_K12C11.1RNAiJA:K12C11.1
PCR_productsjj_K12C11.1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene K12C11.1 Source_evidenceePCR497WS150 Sequence/Annotation Release
Chunk_score Abs_score455
Max_abs_score455K12C11.1
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI13412341342265
K12C11.2 Source_evidenceePCR26WS150 Sequence/Annotation Release
Overlaps_transcript K12C11.1.1 Source_evidenceePCR497WS150 Sequence/Annotation Release
K12C11.2 Source_evidenceePCR26WS150 Sequence/Annotation Release
K12C11.1.2 Source_evidenceePCR375WS150 Sequence/Annotation Release
WB_DNA_textsjj_K12C11.11032caaataaactcttcgttttcggaaaatcccaaatttttaaaaattaaattttattttacatgaaaaaataacacagtaatagtagtaggaatgatgataaattagaatcagtagacaaaaaatcacttggacaagaaatcagagacacgagattcgatgaccttctccgtccattcgcctccactagccatgaagttctcgatctcctcgacggttcgtggaagatcgctcagattctcgttaccagaagcacgaatgatgacgtcatcctcgatacggacgccgcctgatccgcggtacttgtcgatttcggatttgacgaggaattcgctctttttcgggtcggcgagcgcctcgttgagcaggaaatcaatgaaatagcagccgggttcgatggtgattgcctggaagatatcgatttttacgtgaaaattcggaaaaattgaggttttctggattttccagctccgcggggctaatttttctacttttcgataaaatttcggcattttgcatgctttaacagctcaaaactcaaaaaattatcgatttttccgaaaaatttactcccgtgggacagttttgactgaaaaagtcagcttttccacaatttttacggttgcagagctctgccgcctcgattttcacgaaaattatcgatatttccgaaaattttaatgctttggaaccatttttactgaaaaagtcaattttttccaattttaacgggttgcagatctctgacacctggatttctgcgaaaattatcgatttttccgaaaaatttactcccgtgggacagttttgactaaaaaagtcagcttttccacaatttttacgggttgcagggctctgccaactcgatttctgcgaaaattatcgatttttccgaaaatctactgttttgggactgttttgacgggttgcagagctattcaccattctctccatcagcgttctcgtcgttctgaggctcttgagcccgggaagcgttgatctcggcgtcgcatcacccatatatcctccacaatc