Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_M01E11.1   

sjj_M01E11.1RNAiJA:M01E11.1
PCR_productsjj_M01E11.1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSM01E11.1 Source_evidenceePCR784WS150 Sequence/Annotation Release
Overlaps_Gene M01E11.1 Source_evidenceePCR784WS150 Sequence/Annotation Release
Chunk_score Abs_score700
Max_abs_score700M01E11.1
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI55821915583254
Overlaps_transcriptM01E11.1 Source_evidenceePCR784WS150 Sequence/Annotation Release
WB_DNA_textsjj_M01E11.11064atttatggcatcttttgccgtggtggctaccgtatccgcatcaacttccagcttcgtttttggaattcttgcgagtttactgacgattctgattgcttatctgttcgcgagaaaacgtgtattcaccaacaaatcaattctgatgcctgctgcacttttgggctgtgtgagtggattttctacatctcgagtatttttttctagatttcaggctgtagcagtgagcctggcttattcagtatcccatgaaggagaagtattagaacatttatcccattatttcttgtttctctcaatgtttcacttcaccgaattcgtcttcacagcactcacaaatcggcgaacactgcgacctgattcatttttattgaatcattctgttggatattggttggctgctagcattagttggattgaatttttgatcgaggtaggtttttttgaaattaaaactcaaaaaaaaccattggtggttccgaaaaaaaggagaaagatgaggagactttagttttatcaaaaaatgtagtttttggtgagaaaaataatgaaatttatgtctaaaaaataaagcaattcacgccttaattgtacgatttcaggcatacttcttcccagaaatcaaaatgcgtgggattctttggattggaacattaggatgtattatcggagaaatatttagaaaagttggaatggttcatgctggtttggcattcactcatcgattagcaatgaccaaaagatcagatcacagacttgtaaaagatggaatctacgcttatttgcgacatcctggatattttggttagtaaaaattaggagtcctgtgtgagatattattaattctgataggttatctgaatatttcaggttggttcttatgggccgtttccactcaaataatcctttgcaatcctatttgctgtgtggtttatgcctatgtgacatggcacttcttcgcctccagaatctatgacgaagagaaggatctgatttcgttttttggcgattcatacgtggaatatcaacagaatgtctggtgcggtgttccattcgttcgtgggtat