Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_M01E5.5   

sjj_M01E5.5 RNAi JA:M01E5.5
Simmer:M01E5.5:Screen_A
Simmer:M01E5.5:Screen_B
PCR_productsjj_M01E5.5
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS M01E5.5a Source_evidenceePCR1048WS150 Sequence/Annotation Release
M01E5.5b Source_evidenceePCR1048WS150 Sequence/Annotation Release
Overlaps_Gene M01E5.5 Source_evidenceePCR1048WS150 Sequence/Annotation Release
Chunk_score Abs_score1027
Max_abs_score1027M01E5.5
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI1329452213295569
Overlaps_transcript M01E5.5a Source_evidenceePCR1048WS150 Sequence/Annotation Release
M01E5.5b Source_evidenceePCR1048WS150 Sequence/Annotation Release
WB_DNA_textsjj_M01E5.51048ggatcacgagtattcgacaaaagaggctttcaacaagaattttatgaaagattggagaaaagtgatgactgtcgaggaacgtgaacgtatacatgatctgaaaaagtgcgattttcgagctatcgatgcttatcaaaaagagcaacgggaaattcgcaaagcgatgactaaagaggaaaagttgaagattaaagaggagaaggaagcggaagtgaagatttatggaattgcaataattgatggtcatcggcaaaaggttgcaaatttccgaattgaacctccaggagtgttccgtggaagaggtggacatccgaagatgggtcttatcaagaagcgtatcatgccagaggatgtcatcataaattgcggaaaagacactgaaattccaaaaccaccacctgggcacaaatggaaagaagtgagacatgacaatactgttacgtggctgtgctcttggactgaaagtgtgctcggacagaataagtacattatgcttaatccatcttcaaagattaaaggagaaaaggactttgaaaagtacgaaacagcgcggcgacttaaaaagaagattggtggaattcgtgagcggtatactgacgattttaagtcgaaggagatgagagttcgacaacgtgctacggctttgtattttattgataagttggctcttcgtgctggaaatgagaaggatgtagatgaagctgctgatactgttggttgttgctcacttcgtgttgagcacattaagctcttcgattcggcgaaactgaatgaagatgataagaaggaaaaggagtttgttgtggaattcgattttcttggaaaggattcgattcgttatttcaatcgagtttctgttgagaagcgagtctacaagaatttgaagatattcatggagggaaaagctccgagtgatgatcttttcgatcgtctcgacactgcaacactcaatgatcatttgagaagtttgatggatggtttgacggtaaaagtgttccgtacctataatgcttcgatcacacttcaagagcaactgataaagctgacg