Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_M01G12.11   

sjj_M01G12.11RNAiJA:M01G12.11
PCR_productsjj_M01G12.11
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSM01G12.11 Source_evidenceePCR180WS150 Sequence/Annotation Release
Overlaps_Gene M01G12.11 Source_evidenceePCR180WS150 Sequence/Annotation Release
Chunk_score Abs_score138
Specificity_index0.288
Rel_score0.405
Map_statusBest_ePCRI1211675512117360
M01G12.3 Chunk_score Abs_score341
Max_abs_score341M01G12.3
Specificity_index0.712
Rel_score1
Overlaps_transcriptM01G12.11 Source_evidenceePCR180WS150 Sequence/Annotation Release
Overlaps_pseudogene M01G12.3 Source_evidenceePCR171WS150 Sequence/Annotation Release
Map_statusTop85_percentile_ePCRI1212619912126804
WB_DNA_textsjj_M01G12.11606ctgccccatatcaaacgtaaatatgcctgcctacttctatgaatcatcccttccgatatctacctgtctgcttaatttcatgtatcatacctacctatggacctgcctatgtctacgtccctacctactttcatgtatcgtacctacctatgcctacgtgcctgcctccgccaaaacttcaattaactcaccaacataataattccagatccaataaaccacaatccccaatacggcctagccgtatgcggtggcctattgtgcatttcctcgggacatccataataatccggatctaactcgaatccattaagtaccatataagtaaaggttaagttgtaagatggtattattttgtccatgccaaccgacgtgggaatagtaagttcaaaaatgtgcgatatccagtttcggtgcaaaactttcgtctgggcggagtttgttttccgtttttagattggaatcttgtggtagaagaaattattgggtgttagtaatcacatatcacaccttggaaaaaaggttttccggtgcatataaaccaaaaatctgtctggaaagtaatcatgagaatatattctatttttacccaggaagtgtcagaaa