Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_M01G12.14   

sjj_M01G12.14RNAiJA:M01G12.14
PCR_productsjj_M01G12.14
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSM01G12.14 Source_evidenceePCR827WS150 Sequence/Annotation Release
Overlaps_Gene M01G12.14 Source_evidenceePCR827WS150 Sequence/Annotation Release
Chunk_score Abs_score764
Max_abs_score764M01G12.14
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI1210709412108017
Overlaps_transcriptM01G12.14 Source_evidenceePCR827WS150 Sequence/Annotation Release
WB_DNA_textsjj_M01G12.14924aaccgattcctcatccctctcgattatccacctggatctttcaccatttcgcgagagaacgaagcaatctccatcagaaattgctgtttccttgaccaattgcaggaatacacgaagatgtcgttctccagcggcaactgaccagatcttgggtgggaacgggcggtctcccattcgctgagcatgtttcgctgctgccgttgaaggaatcgaatcgcgttccagtttttcaacctaaaattgaacgtttgcaaaaattaaaaaaaaaggaacctactttgtacaacgagaatccgggaatatgttttgaaatcgactgatactccttccccgttcttgatccaataaccagtgttggaacattcgagaagaaggcttgccagtacatccagcaacttctgaatttccacttgtaattgtctagtccatttacaaagactttcagctccacgtgctcgcgactttctgaagattcttaatcaatttatttctaaaaaaaaagaatctaaaaaaccttaccctcatcataaatggcatccatctccccggaatacaaaacactgtaagggtgctcattgccacgtggaattgttgctttgaaaactgcctttctgaccgttccatcaccaccgaccggctcctcatccgaagttttcttgaagaagtgttcaaatttgatggcataattcaaaatatcaggtgtcagatcatcgaattcactagatttcaacaagaaaatcacgccagagtatcgaaaaattaaaagtcgctgagcttgctctttggatgaaaatccagtcgttgcaattgtggtaatagtgtgccggtttgttacaaaatccggttttttcttattcggccaacccatttgattcaaatagctcagtacggattccatatgcttttctccgcctccattatcag