Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_M03A1.1   

sjj_M03A1.1 RNAi JA:M03A1.1
Simmer:M03A1.1:Repeat_a
Simmer:M03A1.1:Screen
PF:GL1_8D10
PCR_productsjj_M03A1.1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS M03A1.1a Source_evidenceePCR1120WS150 Sequence/Annotation Release
M03A1.1b Source_evidenceePCR1135WS150 Sequence/Annotation Release
Overlaps_Gene M03A1.1 Source_evidenceePCR1135WS150 Sequence/Annotation Release
Chunk_score (4)
Map_statusUnique_ePCRII45890324590204
Overlaps_transcript M03A1.1b Source_evidenceePCR1135WS150 Sequence/Annotation Release
M03A1.1a Source_evidenceePCR1120WS150 Sequence/Annotation Release
WB_DNA_textsjj_M03A1.11173atctcccaaccaccaccatactacggtggagtacatccgaatagtggaaaatataagacatatgtggatccaacaacatatgaagatccatatcaagcactcatcgaattcacattcgacatttcaccaaacgacgtcttcattactcaggttattggtggaggagaattcggcgatgtctgcctgggtggtctgtcgaaaaactcgcctgcggccgcgaaatggagtgtttcaaatacaacaatgggacgaggaggaggtggtggaggatacgaatcagaaccatatgagacggttgccatcaaaactctgaaatctggaagcagtgcgaaagcgaaagccgaatttttgacggaagcaaccatcatgggacaattctcacatccaaatgtgattcggctcattggagttgtgacgtcagcggagccagtgatgattgtggccgagtacatggcaaatggatctttggatcaattccttcggaatacggatcaacgaggagagaaggttcattgggagaagatcactgaaatgttgtatggaattgcttctggaatgaagtatttgacagatatgggatatgtgcacagagtaagttttttgagataaagaaggtcttaaattcattaatcattattttccaggatctcgccgcccgaaacgttcttctcgacatggagcttcgctgcaaaatcgctgattttggactttcccgtggtgtcagaagtgaaggatcttctgtcgaacccgaatacactacaaatggcggaaagattccagtcagatggactgctccagaagcaattacccatcgaaagttcactccatcctctgatgtctggtcgttcggagttgtgatctgggaagtgtgttcattcggtgaacgaccatattgggattggacgaatcagaaggtgatcagcgaagtgatgatcggctatcgactaccaccaccgatggattgtccgatgggattgtatcggatcgcccagtggtgttggaagatggagcgacacgagcgtccgacgttcacacagcttctcgccacattccacaagtacatcctgcagccgacacttattgagcatgatcctggagagcttccgcgacgggttcagagtcaatctgccctgaatacctatggatctgtgaatgtcggagtagttccaaccc