Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_M04C9.5   

sjj_M04C9.5RNAiJA:M04C9.5
PCR_productsjj_M04C9.5
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSM04C9.5 Source_evidenceePCR774WS150 Sequence/Annotation Release
Overlaps_Gene M04C9.5 Source_evidenceePCR774WS150 Sequence/Annotation Release
Chunk_score Abs_score699
Max_abs_score699M04C9.5
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI93598629361518
Overlaps_transcriptM04C9.5 Source_evidenceePCR774WS150 Sequence/Annotation Release
WB_DNA_textsjj_M04C9.51657cgaatattgccagtttccgtatttttcacattagtggggattatatcctctgtattgttatgtctatttattttttattatcgtcaaaaacagacaatatttttagatatctgatgacaaaaaggcttggagatggaacattcggtgaagttatgcttgcaaagaaaatagacactggtgatcgagttgcaattaaaaggtgtgtagttgaatggatccagataataatgcccagactatttaaagttttcaatcattttagttcgttttgcacgaaattcatgttgtttgataaaacttaatgagaattagttttttgcagaatgaagaaaaagttctacagttgggaagaagcaatgagcttacgagaagtgaaatccctcaaaaaactcaatcatccgaatattattaaattgagagaggtaagagaaaactcagaaagattagatttcgttgcgaaatattcatgcataagtcacaaaaatacgaaaatctgaactcaaaaagtaatatgactctctctgattaatttttagccaatttttttttcaaaatgcacataatcattctcaaaactatatagtcaaacatacaacttttaaactacggaaagagtcgaacattcggaaatatgaaaattttgaaaaactaaagtgacttattttttccattttcatagtcctagtgatggtttagaatggcgactactgtagtgttactgtaatggtttggtgaaggtactgaaaatagtactgtaggattactggaactattctgaaaatccgttcaaagcttttgagggaagactgagttgagtgtcataacactgcagagcctctgaggaatcactgtcctgtagagttactgtagctacactgtaaaattttagaaacttcttgaattctctagatgcttttgaaaaacttgtaaaaactccttcaatatttatgaaaaaattttaaaatggacaattggatgcattttctgtagttgtacaacaaataaataaataattgaaatcccattttgcaggtaattcgtgaaaatgacattctctactttgtgttcgagtttatgcaagaaaatctgtacgagctaatgaaagatcgtgatcgttattttccggaaagtgttattcgaaatataatatatcaagtactacaaggacttgcattcatgcataaaaatggattctttcatcgagatatgaaacccgaaaatataatgtgtaatggaacagaacttgtgaaaattgctgattttggattggcacgagaaatcagatcaaaaccaccatatacagattatgtatcaacaagatggtatagagcacctgaaattcttctgagatctacttcatacaactcaccaattgatatgtgggcattgggatgcattatggcagaactttatattctaagaccacttttccctggaacttctgaaatggatcaattattcaaaataatatcaattcttggaactccaaataaggttcgttctttattatgacggggtggaagcagaatttttcttcatttccccacgaacataccttagcaatccgtgaactctgttacaaatttaacaagtagagaacaccaatagactgatcacatttattcaatatattaataatttcaggatgaatggccag