Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_M04F3.4   

sjj_M04F3.4RNAiJA:M04F3.4
PCR_productsjj_M04F3.4
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSM04F3.4 Source_evidenceePCR474WS150 Sequence/Annotation Release
Overlaps_Gene M04F3.4 Source_evidenceePCR474WS150 Sequence/Annotation Release
Chunk_score Abs_score390
Max_abs_score390M04F3.4
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI47716134773133
Overlaps_transcriptM04F3.4 Source_evidenceePCR474WS150 Sequence/Annotation Release
WB_DNA_textsjj_M04F3.41521tgaaaagaccattgtcaggaactgctcgtagccgacggtgatgactccatcgcggtccgtgtcgacgtctctgaaaattaagtaatcagattgtaaagtatgatactccaaattttttggtcaaaaattactatagaaacatagaaaatagttagttccatctaaaaatatttttaaagtaatatttaattttgttgaaaaattttgaattttttaaaagagcttttctctaaatttctaaatcaattttagccctgatttctaacctgaaggcagcagtgagggtctgaagaacgacgcaaagttggataaaatcgtcgaaattgattcgattactgtgggatctgtcgaatttgtgcataaggatgttgtagaattgtggagagagacggtatcctgaagaaatatatgatcagtcatcgagtttccgattttcttatcgcttttctatgattaaaaactaaccaaattgtgtgagagcattggtcagctcactcttatcaatatttcccgaaccatcggtatcaaaaccacggaaacagtttgtccagtcgttgatatatctccacagagcctgaaaatatgattattttcacaaattctggtttatattttttcaaacctggaattcttgaaaattgattgcgccgtctccattcgagtcgaacattccgatcattaaacggcaagtttccggattgaatgggttccatgttccgttggagagagcagtttgaagctcatcggaactgatttgccctgatctgaaaactgggaaattttgtttaatttttaaatattatgtaaataataaataaaattttaaatattaaatattaaataaaaaaatataaataaaaattttaaatttataaatgtttgtttttgcgattcttggctcttgaaaaaatacaaaaattatattctgcgcataaaatacggtaaccagtctcgaaacgacaagttctggtttttgttaaaagatacgcgcctttgaagagtactatagcttcaaagttcatcgatttttcatattttttctcgtgattttatacaaatttgagcgtttcattttttttaaacataaatatattttgtatcaaaaaattatgaaaaatcgataaaaattccgcagcaataaaagtttgaaactacagtgctctttaaagggacacacatttttccaaaaacagaaatttgtcgtgtcgagaccgggtacagcgaaatttttttttgtttttttattcataattttgacaataaattttcaacgagaaacatatttattgattttatttactccaattttaaaattgttatatcaatttaactattaaaactattaataaaaacataccgatccttgtcgacagaagagaagatttgttgcaagttaggttgttgaaaagccatctaaaaatggataaaatctgtgtgaattggtaaaataaaaataaaatgaaatgagagaagaatgtgaagtactcaaaagagacgcagacggtgagacaacaacaaaat