Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_M7.1   

sjj_M7.1 RNAi (6)
PCR_productsjj_M7.1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSM7.1 Source_evidenceePCR444WS150 Sequence/Annotation Release
Overlaps_Gene M7.1 Source_evidenceePCR610WS150 Sequence/Annotation Release
Chunk_score Abs_score505
Max_abs_score505M7.1
Specificity_index0.847
Rel_score1
Map_statusUnique_ePCRIV1108143011082308
F52C6.12 Chunk_score Abs_score91
Specificity_index0.153
Rel_score0.18
Overlaps_transcriptM7.1 Source_evidenceePCR610WS150 Sequence/Annotation Release
WB_DNA_textsjj_M7.1879ggtgtggattgaataagatggaaagggtttggagatgaatgggagacacagagagggaaaagaaacacatggtttattgattggtttggctgcgttcttgtatgaatggtgttagcctcctcacatagcgtacttttgcgtccattctctcgccaattgattgtacctgaaaatcgattatttttagtagttaaaagaaaatctaaattcacctttcacgatccgtcttgtagatgcgtgcaatctctggcacaagtggatcatccggatttggatcacagagcagcgagcagatcgaaagcagaactgaaaattaaaagttagaacgcgaacaataatgataatatcaacctttcgaaatggtcagagccggcgaccactgcgaacggagaatgtcaaggcagatgcttccgtttgaattgatgttcggatgataaattcgagtggtgaaggcaacctgaagaaaacaaattaaatttatttttttccaatttcgatcaatacctttggtggtttgaatggatagtctgttgggaagtggatagtgaggaagaagacacctccctgatagggagactctggtgggcccataatcgtagcttgccaatggaacaaatcatcaccaactggtccagcggagcattgtgcgggtggatcacggccgagatcttggagttcctgaaacgtacataataattttattgttgttaagtgttgaaaccttaccttctggattcttttgagagccatgttggtgttctgatttgctgattgacccggctacacccggagtactctgaaaataaatttcgataaatacggtgaaattgagcttctgctatagggaaaaattgaaagtgaggattttcgcatgaaata