Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_M7.1   

sjj_M7.1 RNAi JA:M7.1
Simmer:M7.1
WBRNAi00060823
WBRNAi00060824
WBRNAi00060825
WBRNAi00060826
PCR_productsjj_M7.1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSM7.1 Source_evidenceePCR444WS150 Sequence/Annotation Release
Overlaps_Gene (2)
Overlaps_transcriptM7.1 Source_evidenceePCR610WS150 Sequence/Annotation Release
WB_DNA_textsjj_M7.1879ggtgtggattgaataagatggaaagggtttggagatgaatgggagacacagagagggaaaagaaacacatggtttattgattggtttggctgcgttcttgtatgaatggtgttagcctcctcacatagcgtacttttgcgtccattctctcgccaattgattgtacctgaaaatcgattatttttagtagttaaaagaaaatctaaattcacctttcacgatccgtcttgtagatgcgtgcaatctctggcacaagtggatcatccggatttggatcacagagcagcgagcagatcgaaagcagaactgaaaattaaaagttagaacgcgaacaataatgataatatcaacctttcgaaatggtcagagccggcgaccactgcgaacggagaatgtcaaggcagatgcttccgtttgaattgatgttcggatgataaattcgagtggtgaaggcaacctgaagaaaacaaattaaatttatttttttccaatttcgatcaatacctttggtggtttgaatggatagtctgttgggaagtggatagtgaggaagaagacacctccctgatagggagactctggtgggcccataatcgtagcttgccaatggaacaaatcatcaccaactggtccagcggagcattgtgcgggtggatcacggccgagatcttggagttcctgaaacgtacataataattttattgttgttaagtgttgaaaccttaccttctggattcttttgagagccatgttggtgttctgatttgctgattgacccggctacacccggagtactctgaaaataaatttcgataaatacggtgaaattgagcttctgctatagggaaaaattgaaagtgaggattttcgcatgaaata