Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_M7.5   

sjj_M7.5 RNAi JA:M7.5
PF:GL1_8E2
PCR_productsjj_M7.5
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene M7.5 Source_evidenceePCR1101WS150 Sequence/Annotation Release
Chunk_score Abs_score1038
Max_abs_score1038M7.5
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIV1107905511080250
Overlaps_transcript M7.5.2 Source_evidenceePCR1101WS150 Sequence/Annotation Release
M7.5.1 Source_evidenceePCR1101WS150 Sequence/Annotation Release
WB_DNA_textsjj_M7.51196cagaaaaccgcgaatttgatgtggagcagctccaaggactgttgtattatcgtcgtggctggctggtgtcttgagtggatcagggtattgtaaaacagacgataagagttcaacggcaattccagatgcaatcatagatgttcctggtcgtgcaacctgaaagaaagcatccgttttgaaatagaggtgtggaagttcaaaaactcacagtgcactgttggtccaatgttctatcgaaagtagaatttcctggagcagttacatcactgcagaaatagcaagaaagctgagagtatggtacggaatctgatgatgaaacatctgaaacactttcgcttctagaaccaattccatgccgaatgatgacgtaggtatcgaatccaatcgcgacactaattgcaatcttcttatgtctactagccaaaactgttggaagccagcgagcttcccttgaatctaatgctaggaaaacaacatcatgatctttcacaagttgctccaattttgcaatatctttttccagctctggtacatctttttcatcgatagaatgtccaggcattggaacagtgagacgatgagcagttgcttgaatcgatgggaaaatgcgttggatagcagcttgtgctgtttcggcttttccacgacccaggcgtgcatcttcaaattctgagagactctggcgaacggggttattgtagctgacagttgaattatcaagaaacgaaatgtgacgaactccccatccgataagacaacgggcaatgttacatccaagcgttccagcaccaagaatgagaacctggaatatgacaaaatataaaatttaaaatttaaatatataccttcagctgtgagtatctttccaattgaatatctgggtgcaatctccatttgattaatgataaattaagatccacagatctttccattaatatttttggatcgaactctttacttaagtctactgaaatcggctgcaacttatcatttgcatttctttcccatcccacagcttttggaacagcattctgagctccatctgctgagcattcagcactcggcaaggtccatgtgtattttattccgatactgtcagctgaacgaagactgatgatatgacaatgcttccacgtaggatgaagatgtgccactgcggcaagaacgttgcgaaccatccatcctgcagaatacgc