Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_M88.2   

sjj_M88.2 RNAi JA:M88.2
Simmer:M88.2
PCR_productsjj_M88.2
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSM88.2 Source_evidenceePCR649WS150 Sequence/Annotation Release
Overlaps_Gene M88.2 Source_evidenceePCR655WS150 Sequence/Annotation Release
Chunk_score Abs_score550
Max_abs_score550M88.2
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII45415424542712
Overlaps_transcriptM88.2 Source_evidenceePCR655WS150 Sequence/Annotation Release
WB_DNA_textsjj_M88.21171cattaaatcgtggttggaacattgctggtcctgcattccaagcttcaactttaactggcaattcgtttccgtaaagatccaaaagtgcattcttatcaacttcctcgtagatcgacacgctttttgttgaaggagcttcctgaaatggttgaaaattgaaaaataaaattttgtgagtttcggagttttttatttcagcatatacatagttaatcccacctgtttgatgaacggcttcaagtgctggaactctggatcgacactaagtgtgagcggagcccgtcttgacacagttttctcatccaaaccatttttgcgagcacttttctgtgacaaatgaacttgaagtggtggcaatggaaacgaatcgggaagaacaagatcttgcattggtgttgtgctcgatgtatatgatttttcttgatgtctgaaaataaacgaaaatttcgaatcctcaattaagaattgcttacttgtgtaccagctgccagtcacttctgttcaaatcctttgaaaactcataaacgccaagattttttccacgaaagacccattcagcataaacttttccttcgaataaccatcggtccatgcctggctctgcctgaaaagtttcagtgatctttgttcatgctaaaaatcaagaatgccctcaaaatcttcatatatgacggattattcggccatttccgtgtccattcattctttgtaacaagacgaccgacaccaaactgaaaaaaaaacaattgaatcaagggggaaaacagcagaataacatacgttgcggagttgtgagagaatctcgaacaaaaactttccttccgatgcaatatcatgatttccaacaaatctgattaagtttgaagacatttttatctgaaacttttaaaattgactgtgaatcttgaagaaaaggaaaaaattagagaaacaaattaaatgctcgaagagaagaaaaagaatagaaaaaatgcgcggcgtgcttgcaatgaggcgcagtgcagccgttttagccccgccccttgaaatattcttccttttatttattcagattttcaactttaaaattattttaagcatgtgtttagatgttttaatttcattttcccaaactaaataaaactttagacagttttttcatgtaattaatgacaaaaatgccacaattttc