Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_R05D11.5   

sjj_R05D11.5 RNAi JA:R05D11.5
PF:GL1_2F5
PCR_productsjj_R05D11.5
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSR05D11.9 Source_evidenceePCR759WS150 Sequence/Annotation Release
Overlaps_Gene R05D11.9 Source_evidenceePCR796WS150 Sequence/Annotation Release
Chunk_score Abs_score691
Max_abs_score691R05D11.9
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI85950608596099
Overlaps_transcriptR05D11.9 Source_evidenceePCR796WS150 Sequence/Annotation Release
WB_DNA_textsjj_R05D11.51040gcccatctcggtcaatctaagagaactatgcaaattattttttcaggaacactcaggattctggaactctttattctatagtggtgattcggctagaacacagtccagtcgaagacttgttagcgaattgttaacactaatgaaagacagcgattcttatgttggaactcattttatgccggaaatggaagattctgtattggcaaatagaacagggaatgaaacttttcataaggaaaagtaagaaaatactgattaaaacactttttattgattgaaaaattatttcagattatacacatcacttttgaacgaaacaccaaaatctggtcttggaatacctgatcattttgttgatggaccatcaaatcatatgctgttaacaccaatcggacaacgacaagttttgaatagagaaaagttagttttaattgtctttcgttatatattatcgtattatattatcttttgtagacgttttgactactccaattgcattaaagatgatccaaaagctccaacaagaagctacgaacttgggattgctgttaaattgacgacttctttggctcagaagctcaacgaactttcatttgttcagaaaattggagatcattattcacaacaaagtggtaagttggaaattattgttttttttgtaattcatgttatttcagtaattggtgcaattgctcgtaaagtaatgtatccaccggtgccaaatctagatccgaatgcaacagttccagcgtattcagcaagaattatacgatcacctcctttgcttcgtttacgggtaatttaaaagggattatccgccgattttaattggttttttttgcagtattttgccagctaccagtcaattttcttcatgatatggctactattcgctctgaaatacggattaacttttacaattgtctctctgattctcatcgcactctcggtcactgtactcttgttcattgagctcgattccgggtcttcatcatcttactgacacttgtttgtgatttctctgctccaccactgtcatc