Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_R05D11.6   

sjj_R05D11.6 RNAi JA:R05D11.6
PF:GL1_8A7
PCR_productsjj_R05D11.6
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSR05D11.6 Source_evidenceePCR818WS150 Sequence/Annotation Release
Overlaps_Gene R05D11.6 Source_evidenceePCR818WS150 Sequence/Annotation Release
Chunk_score Abs_score692
Max_abs_score692R05D11.6
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI85970258598413
Overlaps_transcriptR05D11.6 Source_evidenceePCR818WS150 Sequence/Annotation Release
WB_DNA_textsjj_R05D11.61389aagattcgaacaatgggtgctggaattgctgctaacaaagtaagtgatcttcattatttaaaaatatatttcaaatttaatattcaggatcgtacaaaaactggaagttacgtgaaggcatctgcagcgaaaaagcgacaagcagtgaagacatcagatttagaaggagcttctgatgagtctaagtaaaaaaaacttttcaaaaattgcaattttcaatctttttgttccagaaaagtaaaaatggaaaagtctccatcgccagtagctcgtgaatcttttgatgaacgtcttggaaaactcaaggcatctcttgcaatggtgaacatttcagatttaacttttaatcttttaatcttttaatttcagacacctcaccatctaacgggcgaacaaatgatgaaaactgccacgaatagttgtctcatgaagtggcacgtgaacaagattaaccagaaaattgaaataactatcgatcgatatgtggccttcagacatacgtttgtataaaaatcttcgaaactatttgaatttcatgttctttcagattctcccaatactgtgttgatccaagggattgtgcaatcaatactctaattgaaagcattctttcgtgtgacgccgctgttcacgaagaaagctacgaaattagatttgatggagttccggtggacgagtgttacgctaaatcagtcaccagaagacttgcaaaaattaaatcagcagtttctaatggtgcacatacagttaaaggcgagcttttttcatttaaaaaaacagtatcactaaattgaatgaaacatttggtctcaaaagtaaggattataaaagttggaacaatatctcttcaaaaatcattttagaagtgggattgttgaatttgattgcaagctcgttttatcaattttcggctgtaaacccatttttattagcggcaacacgtttaaaaattttaaaatattgcttccggtacttatggatgccgttccctgaaacaattatttttagaaaatatatttgaaaattggaagaaaaaaactcgaaagtttgttacagtactcaatccgaacggcaattggaaaacaaataattttgccttcttttgaaaaaatgtatttagaaaactttttcaggtcttacaacatatttggatgcagttaacatgtcaatgattcaaaatactcaaaaattggaaggatggtctcaacaacttgatctcgtcactgccgatcttcttctatcttctcgtgttttatccagcactgaatgcactaaaccagcgatggcaacgatcgcgaatcaaatgagcgaagacgtgtgtcaactgattctcaacgataaaatcaacgtcattaactctatgaaatctcacagctctcttgcattcca