Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_R05D11.7   

sjj_R05D11.7 RNAi JA:R05D11.7
Simmer:R05D11.7:Repeat_b
Simmer:R05D11.7:Screen_A
Simmer:R05D11.7:Screen_B
PCR_productsjj_R05D11.7
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSR05D11.7 Source_evidenceePCR468WS150 Sequence/Annotation Release
Overlaps_Gene R05D11.4 Source_evidenceePCR78WS150 Sequence/Annotation Release
R05D11.7 Source_evidenceePCR581WS150 Sequence/Annotation Release
Chunk_score Abs_score539
Max_abs_score539R05D11.7
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI86010168602088
Overlaps_transcript (2)
WB_DNA_textsjj_R05D11.71073aaaatatcgacgatttcagcaaatttcacaagcattcagttttgtttggttcttgtccaataaatttctcgatttcttttttttcttgtccaaaaaaaaacgttttattgaaaaacaaactaattctttttccttgtactcggcttctggtttagagcagaaaactcatttagaaatataaaattttaattatttcatttcttactcgttatgatgacaataaaggagaattgagtcgaattttccgcggaaaaattctttatgacgacttttcttttcaagcttcgtaaatagctttgcgttttactttcgttacaagtttcgtttatttttcagttcgcgagcaatgggacgtgacagaagtcgcagtcgcgataggaagagacgatccagatcaagatcagtggaaagaaggcgagaacgaagtagaagtcgtgaacgtcgagatgctcgcaaaaatcgcgacgaaaaagaaaagagaagcagtcgaagcagaagtccgcgcgataaacgagatcggcgggaaagaagtcgatcacgggatcgaaaagaacgtgatcgtgaacgacaaaaaaaggatcgtgagccaaagaaacgagagaaacaagaggagatcagtctagagtcgttacaaagtggagcagacgatgaagcgatgatggctgcaatgggatttggtggattcgatacaactaaaaataaacaggtatatatttattatctttgaatattcttccacaaattaaaattttttaaagatttataatttttcaggtcaatgacaacgtggatggctgcgtgaacatcaagaaacctcgcagataccgccaatacatgaaccgaaagggaggattcaatcgtccacttgattttatgggataatttatttttttgcaataattattgtttttcttttcaatttgatctctttcatttagagaataattctgtacccaaatcatttttatttcaccggaacgttatttttaaaataagaacttttaaatgttttgttcttatttatatttttccgaggttctattccttttttatcttttatcgctctacggacg