Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_R05D7.3   

sjj_R05D7.3RNAiJA:R05D7.3
PCR_productsjj_R05D7.3
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSR05D7.3 Source_evidenceePCR947WS150 Sequence/Annotation Release
Overlaps_Gene R05D7.3 Source_evidenceePCR1041WS150 Sequence/Annotation Release
Chunk_score Abs_score915
Max_abs_score915R05D7.3
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI1216825112170440
Overlaps_transcriptR05D7.3 Source_evidenceePCR1041WS150 Sequence/Annotation Release
WB_DNA_textsjj_R05D7.32190catgattatgaaacgctcaacaatttgtggcaaacccggcaaaaaaaattgaaagggaaaggcaaaaataacaaaatcctaaaattccaaataatcactccatttctgacgctaaaatttccagccgaagtttgggagttttcgacgattttttcggcttttcagaaatctcagaaatttcagttatttcttcagtttctgtatttccgagatcttcagatgttacagcatcatcttgcggattcgtgctcaaatcaacgagtccggaggttgtcgcatcgttttgctcaatttcttgaagctcggattcttggaaaaattgatcatccggtggtggtacggtagcgtcgtcggattctgcaaaaaattattgaatatccgaccaatcagcgatgcacggtcgccgttgctggttgattggcatcaactaatcagcaatgagggtctccgtttctgattaattgaaaccgtccaatcagcagtttagagagggcttggccaacgtcactggctggctggcgccaaccaatcaacgatgaggacagtcttcgctgattggttgaaaccaccgaccaatcagcaattcaaagagggcgtggccaacgtcactgattggttggcgttgcccaatcagtgctgcaggaccaccgccggtgattggatgacgctgaccattcagcaaagcggggaggaggccagggttgcctattggtttacgctgaccaatcagcgatttagcgccagcatcgttaattggttgatgctgtccaatcagcgatgtagggcctccatcgctcattggtcgatgctgaccaatcagcaaagctgtgagggagccaggatcactgattggtcgtttctgaccaatcagctacgcaggaaaccaggtttgctgattggtcggccctggccagtcagcaaatccggaccaaagtcgctgattggtcccagcatgtgctacaaactcacgcagcctagactctgatcctccccgatgtgtcaatgagatgtccgtcagggaatccacgtcagcaagtggggccagacgattggcatccagggtgacaaatcttctgaaaatttgaatatgaggaagttgtgcttgtgtgtgatgtctgcttctctgcgtctcttcctcactctcttcactctcttcactctctacccacgccaacttcaaaccctcacacctcgctaccctttacagctatcaaaaaatttccaactgacaaaatatttcaaattttcttcttttcaatttactagttggcaacttttctctaactctagccacaacgaagataccttccatctccaaaaaatgattcctttccctcatcatcatcaataaaaacatcattatgctcggctttctcctcttcttccgatattaatcgtcgtcgcttctgaagaatcgactcttctgtgatgatttgtgcatgtttgtcacggctctccagggttactacgcaggcgattatgaggataaatgagccgattcccatgaggattggaccgaggtactgtaatagcaattattgaataatttttttttgttttagggaaaccgactaacctgcatactcttaagctgatattgtatcattctgtcgtaggagaccttttcagaaccatcgattatttctactttctgtaaaggaaaaaagtttagtttttggtttttgtacccttttcaaagtcctatatctccctaatcataagaggtatcaaaaaatgttcaactctcaaaatgtttatacttttatggttaacattttgctagttgacaactttttcataactctacccattgcatagactcacctccgagaaatgtttgtcgaaatatcctaaaaccgtcatggcaaggccgacgcaaatgatgatgcatccgaagataaccgcccggcaggctgcccatactgtctgaaaatatttttaaaattattgaagggttttttaaaagttaggattttatatttttattttttgaaaaaaagttaactttaaaaaaaaattttaatttttttagtcgagcaaaaagtgttttcaatttacatttttgtgaaacatgtgttttaaaatttattgaaataattttaaaattttttacggcaaaaatttccgaaaaaagtgatttttttttaattttctgaaaaaaaaaattatctagggtatctaggcaggcag