Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_R05D8.a   

sjj_R05D8.a RNAi JA:R05D8.a
Simmer:R05D8.a:Repeat_a
Simmer:R05D8.a:Screen
PCR_productsjj_R05D8.a
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS F54E2.3a Source_evidenceePCR2334WS150 Sequence/Annotation Release
F54E2.3b Source_evidenceePCR2334WS150 Sequence/Annotation Release
F54E2.3c Source_evidenceePCR2334WS150 Sequence/Annotation Release
F54E2.3d Source_evidenceePCR2334WS150 Sequence/Annotation Release
Overlaps_Gene F54E2.3 Source_evidenceePCR2334WS150 Sequence/Annotation Release
Chunk_score Abs_score2313
Max_abs_score2313F54E2.3
Specificity_index1
Rel_score1
Map_statusUnique_ePCRV27875732789906
Overlaps_transcript F54E2.3b Source_evidenceePCR2334WS150 Sequence/Annotation Release
F54E2.3a Source_evidenceePCR2334WS150 Sequence/Annotation Release
F54E2.3c Source_evidenceePCR2334WS150 Sequence/Annotation Release
F54E2.3d Source_evidenceePCR2334WS150 Sequence/Annotation Release
WB_DNA_textsjj_R05D8.a2334tctccgttgtcttctggatatgttgggctgatctcaagaacgacgtacccaaaactgttgatagtcttgatacgacttccattcttcaatgggcgaccatcatggtaccattgaacctgaagctgattgtcattgactggctcgtaacgagccgtgaaatgagcacgtccgccctcctcagtttcaactggagccgagagtggctcaatgaagactggtgtagcctccttaagctcttgctcgatttcttcagggcgtcttcttaagttatcctcgagaatttcgacggccttcgccttctgttcattctgtggctgaagaataagaccagagctctcggaaacttcgaaacttgtagaagtagatgcttctcccgagttgttcgaaactcggaaagtatactctccagcatcgtgtttcagtagatgcaaaatgtccaaaacagcgaatccgaagtcgtgaaccatcttgtatctatttgagtggaagatcggttgaccatccttgagccattccaccttgatcgagggatcagccactggagtgaattgggtttgaagatgagcacttcctccctcttccaacgctccctggacttgaagagcgttgacgatagctggagcctcaaactgttgatctgggcgctcttctggagcaggttttccagcttcaatctggcgaatacgatcaagtgattgtggctggagagagtcttgaaggataacttcctttccttgaacttcaatcgttgctgttgagacagcttctccagctgcgttcttagcaacacatttccattctccagaatctcttggttcggtttgagcaatatccatgatcacccatccaaaatcattgatcatcttaacacgagacgacgcagacattggctctccattaaggaaccagttgatcgtaagagttggatcatcgactggttcgacagtagcttcaaagtgagctggttggttttccacgagacttcccgggctggtgagctgttggatgaaccgtggtggaccctttggctccggatcggcttcctcaagcttttgctttggcgcctcgatttcttgaatacgcttccagctttcttgatgttgcacgtctccgagaattgcatcctttccatgacacttgagcgtggcagatgacacagcttctccttctggattccagatacgaagttgatagacaccttcgtcttccggataagtgtaggcaacatcgagagtgcagattccaaagtcttgttgaatggcgtactttgatccatgagcaagtggaactccgtttcgaatccattgaacttgaagtcttggatcgttgactggagtgatgagtgcctcaaagtgaacgtggtctccttcattgcactccttatcatcaatctgcgtggtgattgctggatggtcatatactggagctggcgcttccggttcagcttcctttggagcttccagaatctggatgcgtttccatgattcttcatgacgagtgtttccaagaatcggtccagttccggctacccggattgaagcggtcgacacagcctctccttcgctgttggtaattgtaagagtgtacactccattgtgatcttcatttgctgaggaaatgtccagtgtagcccatccaagttcatgtttagtctgcaccaactgtgaagctccgagtggctggccgttcttctgccaaacaaccttaagttctgggtctctagctggctggaatgtagattccaggtgaagtgggactccttctggaacattttcagccgactccagttgagtaaggaagtttggtttctccttttgaacaatttcctcaatttcctcgacgatcttcggagcctcaagctcttgaatacgctcccatgaaactgggtgctgcgagtcgtacaaaatcttctcgtagccagcagtagtcacggtcgcagatgttgaagcttctccttgagtattccaggcacggcaggtgtaaacaccagagtcgtgtgggaggacgtgaacgatggtgaggattgcgtttccgaactcatactcttgacggaaacggtttgcatttcgaagtggagttccgttaaggagccattcgagacgaagatgtggatctccagatggttcgacgagtccatgaagagtgacagtttgtccttctccaacattttcgtagttttcgaatccttgaacccattgaggtttctcgtattctctttcaggtgcatcaagtcttgcgtacttgtcgatagcctcgagctcttgaatcttctgaagagacgctggatgagaagtatccagaagaaggccttctgatccttgaactccaacattc