Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_R05F9.8   

sjj_R05F9.8 RNAi (5)
PCR_productsjj_R05F9.8
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS R05F9.5 Source_evidenceePCR35WS150 Sequence/Annotation Release
R05F9.8 Source_evidenceePCR384WS150 Sequence/Annotation Release
Overlaps_Gene (32)
Overlaps_transcript R05F9.8 Source_evidenceePCR448WS150 Sequence/Annotation Release
R05F9.5 Source_evidenceePCR35WS150 Sequence/Annotation Release
WB_DNA_textsjj_R05F9.81032tatttctaaagagcagtgggcagaaattaaaaatagtaagttcaaaagttgcattttagaatgaaatcctcagtttaaaaagttgattaattacaatgtagcgaaatgcttcagtttttaagtggtatcccgccacgaacaaaatatcctcacataaagattaaggtgtgcctttaagcagtacagtaacccattttacaattttattcgatttttccacattattaaataaattcaattcgattttctactgaaaaaaatcgaaaatataacaattcaaatatatatttattattggggattttggcagatactgcagaaatttaaaaaactttgcaatgcaaaaaaaaaatcaaaaattccaggcttcttttggaatcattttggcagaacctgcagaaatattaaagttcggtttttttaaagagatgatcgaagaaacattgtagtgtcgagccagctgatctagaggaaaatgctcaaacgaggagtggaaaggaagctcttttttcgagcatgacaatattatctcgtttgaaaatctctgaaaatatgttcaagtaaaaaaaaacaaaaaacgagctatcaatgaaagtttattgaagttttggaaagttcacaaatcctatgggttgtactcgattgggaggttcttacgacgaaccataccgtctccttggaaccattcccgacggaattgcttagcagcaccatccggagtgttggtccactcaacagtgatacgatcgttgttagtgtcctcctgtccaaaggcgaaggcatcgcaggaaactgccagaaaaacagcttcctttgggtccagaactccacatggtggatcaactccaagtctcttcatattggtggtcttgataccgtatccaatacggcgagcagatgagttgatcaccttgatgtggtaggtgtgcttgtcgtcgtacggggcattgaacacgatcttcgtacccggctgggtctggatatctcctggtgggacggattgggccatggcgacttctttgtagagtgaga