Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_R05H11.1   

sjj_R05H11.1 RNAi (5)
PCR_productsjj_R05H11.1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSR05H11.1 Source_evidenceePCR1083WS150 Sequence/Annotation Release
Overlaps_Gene R05H11.1 Source_evidenceePCR1083WS150 Sequence/Annotation Release
Chunk_score Abs_score978
Max_abs_score978R05H11.1
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII67955446797205
Overlaps_transcriptR05H11.1 Source_evidenceePCR1083WS150 Sequence/Annotation Release
WB_DNA_textsjj_R05H11.11662caaaccaacgagctgtttcagataataatgcactgttcaaaatcagatccactacttttatctccgattcatccattcctaaatcttcttgctttaccaaaaaagtcattgaaaaaattatacgagtacttgaacccaatcgattggtaagttcctatcaaaatcgttcaacttttatcgaaagaaattactatttttagttacaacattgcaaaatgctcgaaaaatctggaggcacaagtgagaaagtacaaaaaccctgtgatcaactatatttatatgagatttgacgacgaaaagtcatgcattggagtttattttgaaaaatataaatataatgcatgcgtattttattcatggagagataaagatggaaagcgaacaatttggaataattcgtactatttgaaatcgagcaaatttcaaaattacatgttttgcaagaggtcagttttgttcgaaaaaagacatcaaaaaattctaaaaagttttgattctaaaaaagtgtacgttttgcggggaactttaattattcaccaaagttaaaatttaaagaacaaaattaccactcaaaaaactttttgtaaaaattaaacctcaattcaattgtttaattttttacagtttattctttgaaacaatatttctagatatttttaaatgcagaaaaacctgtttgcacaatttgaaatattcaaaattttgaaaactcgctcaaaatttttttttcataacatcaatttttcatacagaagtcacccaaaagaagtgaagtctctgcaaccttcaactatcccacaaaactatataaacggaatgcttgaaacttatcaagagttgtgctcattgttctcagctcaagatgcattttactttgtcggagtgaatgtgaatgacaaaatatcatatgagactttctgtacgatgccccatcttcccaggtttatcggaaattttcgtttgattggctcaaaatcgccaaaagttgaaagagtcagagatattttgagaagtgcaaatgtattaggaacaatcagagtttcacatcaaattggatcagcttgtatgcaagaagaggctagttattgagaaatacaatccgtttaaatattattttatagttaatcaattccaaacatattgtacttgatgacccagaatggatcagccgtgaagaattgctatctcttaactgtatcacagttgatattggacataacaatctaacagctgacgatctcaacgcatttctcttgcaatggatgttcatagatagtgatcaaacaagattggaacgaatggaaatcacattgagtccggaggcgtttcgaaataaagctcagattacaaatgggctgatgttgttggattgggacccgagaagaagagagggggaacattttgattcttcgtaagtattcagccagtgttttgaacaaagagagatactctaaaagatttaaaatattctgtacaacattaaatattttaacgtattttttcttagacctcactgaagaaatattccatgcatcagattaaagtcaattaatttacagttactacttgagccgaagtactatccgtgatccataccacttccttgattgcaagttctcgaaagatattctgcgagatgacggacgcctggccactatttta