Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_R06A10.1   

sjj_R06A10.1RNAiJA:R06A10.1
PCR_productsjj_R06A10.1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSR06A10.1 Source_evidenceePCR279WS150 Sequence/Annotation Release
Overlaps_Gene R06A10.1 Source_evidenceePCR279WS150 Sequence/Annotation Release
Chunk_score Abs_score195
Max_abs_score195R06A10.1
Specificity_index0.696
Rel_score1
Map_statusUnique_ePCRI10867791088942
M04D5.1 Chunk_score Abs_score85
Specificity_index0.304
Rel_score0.436
Overlaps_transcriptR06A10.1 Source_evidenceePCR279WS150 Sequence/Annotation Release
WB_DNA_textsjj_R06A10.12164ctccgaaacacgaatttagtgacgtgcacggaattttgctccgcccccttcttgggcgtttttttttctgaaatcttgagtatttaaataattcgaaaagggttctttgaaatttttgaacattgttagcccgaaggcatttttcgacaaaattaaaattttgaaaaattctcaatagagcgctttcacggggttctggccttcctcattgaatttttcgcgctccatcgacaatcgcccgtgtactccacacggacaaatacatttagttttactactaaaatcgagccgcgacgcgacacgcaacgcgccgtaaatctaccccagatatggccgagccaaaatggcctagttcagcaataactcttccatttcaaagccaggagtccgtgaaccctgtaaaactctgtaaaattttgaattaaaaaaaaatttttcacccaattacgggccaaatctgaacattcttccaggttgcccgattcatttgcgcaataattgtagtgattgcctggttgtccgattaccacggaaatccgaccgaagatacgccaaaatcgaaatccgagcaggaaaatgtgacagaagacccgtatgagtggatttctcgtgagtagcgccttgtttttagctccgtccatttattggctgagcaaaattggatttttttcagatcgaaaagcaattttgatcgcattcgccggaatttacatcaagatttttatctcgcaattgtttattctcaataggtgggtcaaatgtgctctataaaatttgccggtttgccgagttgcttgaattttttattttcggcaaattgccgatttgccgtttgccggatatcagatttgccggaaatgtttttgccgattgaaattgaaaaaaaacctgaaatgtacaaaaaaaagtgcaaaacgagaagttgtcgaaaatataagacaattgccgatttgccggaaatttgccgccttgccggaaatttcaattccagcaacttgccgatttgccggatatttgaattccggcaatttgccaattttccgatttgccaccttgccggaaatttaaatttcggcattttaccgatttaccggaaatttcaattggggcagtttgccgagttgccggaaatttaaattccggcaatttaccgatttgccggaaatttcaattaaagaaatttgccgatttgcgggaaatttcaattccggcaatttgccgatttgccggaaatttcaattctggcaatttaccgatttgccggaaatgtttttgccgattgaaattgaaaaaaaatctgaaatgtacaaaaaagtgcaaagcgagaagttgtcgaaaatagtcgacaattgccgatttgccgcaaatttcaattgcggcaatttgccaattttccgattggccgccttgccggaaatttaaattccggcaatatgccgatttgccggaaatttgccgatttacccgaaatttcaattgcggcagtttgccgatttgccgcaaatttcaattccggcaatttgccgatttgccggaaatctcaaatttcggcaatagaaaataggaaaaacaattttacattttttattctcaaatttttttttgcagatactactcccacgcggcggacacccaacgagaagccaaacaacgcgagattgatatggaattttagcgtggtgtggaattacgtggaagtcgataaatcgataatttctaaagaaaaatttaaattttattttcgaatttataaattaattttatcaatcaataatgctgaacgtggatattggtgcttataaacgagatctcgagacttcatggtgtgtatttcttagatttttcacagatttctggcttccctcatggaagagtttttgccgaactaggccattttggctcggccatatctggagcagatttacgtcgcgttgcgtgtcgcgtcgcggctcgattttagttttaaaactaaatgtatttgtccgtgtggagtacacggctttcccacgcgcattttagctcaattatcgatttttcagcaaatttatgaattaacgattttcgcatttaattatcgatttttatctcaaaaatccaaaatcaaaaatcgttgcaagacccatttctattttttcacaggatctaccagtttgcccaatttcta