Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_R06A4.4   

sjj_R06A4.4 RNAi (2)
PCR_productsjj_R06A4.4
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSR06A4.4a Source_evidenceePCR1116WS150 Sequence/Annotation Release
Overlaps_Gene R06A4.4 Source_evidenceePCR1116WS150 Sequence/Annotation Release
Chunk_score Abs_score1095
Max_abs_score1095R06A4.4
Specificity_index1
Rel_score1
Map_statusUnique_ePCRII1436599114367121
Overlaps_transcriptR06A4.4a Source_evidenceePCR1116WS150 Sequence/Annotation Release
WB_DNA_textsjj_R06A4.41131attcgtgcgacagtaggtatcattgtcacgactatcgttatggaggagaatatgtgcgattggccggaccttctagacactctggccacagttctgatgcaacccgacgagctgatgcaagaaggcgctcttggagcacttcagaaggttttcgaagactcggcggatcggtatgagtcggaatttcttcggccaatcatgccgaagcttcttgttttctatgagcatcatgctgcgaagatgcgggctcttgcaatgaattgtgtgaattgcattctaatggttaataatgatccaattgattttgcaatagatcaatttcttacttcgcttttcgctcgccacaatgacaatgatgaggaggtgcaaaaacagttatgtagatcgctgacgcttctgctggacacacacatcgagaaaatgatgcctcatttgccgaatgtcatagaatatattattaagaagactcaagatcacaacgagtcgattgccttagaggcctgcgagttttggctttcaattgctgagaatagtgatatttgccgaacaatggtgcttccacatctcgataagctcataccagttctgcttggctccatgcgatattctgagacagatcctgcgttgaaagctaatgatgaagatagttcggttcctgatagagaggaggatatcaagcctaggtttcataagtcgaagcagcatggtcttggtggccttgtggagtcggatgatgaggaagacgaggacgatgatgacgatggtggtggcgactggaatatcagaaggtgttcagcagcatctttagatgttctggcttctatttttggaaaggatctgttggataagctcttccccctcctcaaggacacattgatgaatgacaactggctggtcaaagagtctggaatacttgcgctcggggcaatcgcggagggatgcatggacggcgttgtgccacaccttggcgagctcataccattcatgctggctatgatgtttgacaagaagccactcgttcgatcgatcacgtgctggacgctgtccagatatagttcgcatattgcatccgacgagaacttcaggcaacagtttttcaaggatgtgctcgccaatgtgagaatttagaat