Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_R06C7.9   

sjj_R06C7.9 RNAi JA:R06C7.9
PF:GL1_2F1
PCR_productsjj_R06C7.9
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSR06C7.9 Source_evidenceePCR769WS150 Sequence/Annotation Release
Overlaps_Gene R06C7.9 Source_evidenceePCR802WS150 Sequence/Annotation Release
Chunk_score Abs_score739
Max_abs_score739R06C7.9
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI72577497258812
Overlaps_transcriptR06C7.9 Source_evidenceePCR802WS150 Sequence/Annotation Release
WB_DNA_textsjj_R06C7.91064tgtcggtgttgcaagtcttcttcatcatcggaagcaaattcatggattgactgcaatgctaacatgtggtgtgtgcacgaaaaagttcaatacactaagttcgattcgtcgtcatatgagtatggaatactcaatcttccgttgccaacaatgtggccgaaactgtatcgatcgaaccactcttgaccgtcacgaatgcttcaagccatacaagatccgagataagagacttttcaatattcaaaatatatcagttctcaagtgccctgactgcagagcaacttttgcaaatttgaatgttctgtctgaacatcgcaagacgtgtcaatacggcaacgtatttgataatattcaacaaccgggaagttcttctttacgacaacatcacaggagcgatacaaatggagccgcgttgcagagaaaaatcacatcccgtgttcgtctagattcgaatactccagagaaatggacggtttgttaattttcctaattaaaaaataacgtttgagaatttataatttcagtgccgagattgccacgcctcctttcataacctgcaagcgttgtgctcacatcgacacgaatctcacggaaaagaaatgtttcaatgcaacaactgttctgaaacccttccaaactatcgtgctctccatgatcataatatgatggtaagtttatatgtaatgaatttatatcacatatgctacaacatgaccagcattgcaggaacaatagatctacaaatgaaacaactacgagaagatattcggaagaagacatcaattacgattacatggacaatgtacaaatattcgtcgtagaagaaagtgaaattttcattcctattcaaccgcatttctcgagaaagtagataattcttaatacgatgttatgtactgctcccttgtgctttattctttacttttcagacaataaaattttgaacgttctgtcttctagatttaaaccttcttcaattaaactccatgtttactattattcgttcttcaacattccacaagaagaaaacgttttgtgattcttaccaagcaaagggagttcct