Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_R06F6.10   

sjj_R06F6.10RNAiJA:R06F6.10
PCR_productsjj_R06F6.10
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSM106.1 Source_evidenceePCR724WS150 Sequence/Annotation Release
Overlaps_Gene M106.1 Source_evidenceePCR724WS150 Sequence/Annotation Release
Chunk_score Abs_score661
Max_abs_score661M106.1
Specificity_index1
Rel_score1
Map_statusUnique_ePCRII1082436010825328
Overlaps_transcriptM106.1 Source_evidenceePCR724WS150 Sequence/Annotation Release
WB_DNA_textsjj_R06F6.10969gatttttcgccgactttcaacgcaatcaccggtgagtatagttttgtgctgaaaactaatagtttgaaaaactttaatttcagcataaaatatagtataataattgttttatttcaggatacaatggtagtggaaaatccaatattctcgattcgatctgcttcattatgggaatcaataagctcgataatatcagagcaagtatgtggctctttctcatcacaaaattattttgttgtcatagtgatacttacgcgctttcggactgaaaaagcacaagatcagagtagcataatatttctagcaaagattttttaaattgaaatttagaaaaaaaaattaagtcaaatatcattccagaatcaatgcacgagctgatttcccatggtggaacaaaagcgatcgtccaagttcgcttcgacaacactgataaaagatgctccccgttcggaatggaacatctcgacgagatcgtcgttcagagaatcatcacagctcaagcaactggaaaaggatgtgcaacgagttacacactgaatgggcatgcggccacaaatggaaaaatgcaagatttcttccgtggcgtcggtttgaacgtgaataatccacattttctcatcatgcaaggtcgtattactacggtgctaaacatgaagccggaggaaatcctcggaatggttgaggaagcagctggaacaaagatgtatgatcagaagaagaaagacgcggagaaaacaatgtttttaaaagatgcaaaactcaaagaagttgatagaatcttccaatcaagtattgatccgagaatggtaaagttccgtgaagacagaaagaatatggtggaagtgactcgtctcaagaaactcaaagagaacttttcccgaaaatacgaggcgtttcaatactttcaaacatgtgaagcggtgaaaaaaagtgcaaaagagattgaagatgccaaaaagggaattgaag