Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_R06F6.5   

sjj_R06F6.5 RNAi JA:R06F6.5
Simmer:R06F6.5:Repeat_a
Simmer:R06F6.5:Screen
PCR_productsjj_R06F6.5
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSR06F6.5b Source_evidenceePCR876WS150 Sequence/Annotation Release
Overlaps_Gene R06F6.5 Source_evidenceePCR876WS150 Sequence/Annotation Release
Chunk_score Abs_score771
Max_abs_score771R06F6.5
Specificity_index1
Rel_score1
Map_statusUnique_ePCRII1079682510798022
Overlaps_transcript R06F6.5a.2 Source_evidenceePCR867WS150 Sequence/Annotation Release
R06F6.5a.1 Source_evidenceePCR867WS150 Sequence/Annotation Release
R06F6.5b Source_evidenceePCR876WS150 Sequence/Annotation Release
WB_DNA_textsjj_R06F6.51198gttccagaacttgttgagcaatccgtcaggtgccttgcgaaccgatggggttccctgtaaaatcttttttaattggttagaaggattgaatcaatgaaatgcttacgtttgttctttgatcggcagccaatggtctcattccgacaccagaacggacggaaatacgagaagaactgaaaacataaacaattttttgtggaaatattaattgaattgtgaaaaattaactttttctttttcacattttcaaagtggagtagcgctagactacaaactacaaacttcgctttagcagattcaagtataaaatttagatttttatgaattttttactaaaaatttctaatcatacttgagcgagttatttgcatcaaaaacattcgacgagttgagcacactgttctcattgtgattaactgattgatcggccatatcgttctccacaaatgagttatacatggaagcagatcggtttgcagctgcagcaatgttagatgatcgagcaacaattccggatgctgagccgttgatcacgtcctgtaaattttaaaattaaaataaaaaataaatatatcctttttacttaccttatttgtgcactgaacgactccaataaatgtatcctgatcgaggagagttccgtttcgagaaatagcttgttgagcgtgtgtgacacacgaatagcgcatatgtatgaagtttccttttgatggagtctgatgactaactacttccccgtgccgcgagaataaattcaacaaaatcgacacttggcttggctgaaatccaaaaacagtgacccaggtatcagctgcgtcggcttcttcttccattggttgttcttctgcttcagccaacctggatgtgactcgttgagtgattggagtggaaagtggtgttgatctggcagtgaatgtatttcgtctggagatctttttcgctggttcaactttgtcgcgaagagatcgaagaggtggtgctgaaaatcaattttattttaaatattcgcgaaaaaatgtaaattctaaccatgcatcgcttgaccaccgaaagatgatgtctgaatcgactgaggagctggctttgtcggcgccgaaaatgatgaatttcctccgaaagacaagttggcaggtgtattctgtgtttgtgccgccgacttttcaccagattgcaccaaagatggagaccaatgaactga