Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_R07E5.14   

sjj_R07E5.14 RNAi JA:R07E5.14
Simmer:R07E5.14
PCR_productsjj_R07E5.14
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene R07E5.14 Source_evidenceePCR496WS150 Sequence/Annotation Release
Chunk_score Abs_score412
Max_abs_score412R07E5.14
Specificity_index0.5
Map_statusBest_ePCRIII44062644407116
R07E5.3 Source_evidenceePCR496WS150 Sequence/Annotation Release
Chunk_score Abs_score412
Max_abs_score412R07E5.3
Specificity_index0.5
Rel_score1
Map_statusBest_ePCRIII44062644407116
Overlaps_transcript R07E5.3 Source_evidenceePCR496WS150 Sequence/Annotation Release
R07E5.14.1 Source_evidenceePCR496WS150 Sequence/Annotation Release
R07E5.14.2 Source_evidenceePCR496WS150 Sequence/Annotation Release
WB_DNA_textsjj_R07E5.14853gtctcaatcgcttgaagagaaaaatgagcgacaacgaagtagagatggaggatgtggtggccaacgccgagagatcaagaggtcgaggacttgcgcaggtaaattttgtcgaattttgtaatcaataatcaataatatatttttctagagtcgcaatcgcgagaggatcacctacgacgtggtcgatgaagagtcgtctgccacaagcggagcaccacaaagatccgttgaaggatggattgtcttcgtgacaaacattcacgaagaggcaacagaagatgatgttcatgacaagttttccgagtacggaaaaattaagaacattcatttgaatctcgacagacgaaccggttttttgaagggatacgcactggtggagtacgaaacgcagaaggtaatattttagcagtcgtcgtttctatcgaaatcatttactatatataaagcgcttattctgtgtgtccatagtttgtagtctatgtagtctttgtagtctgtgaagttttggcttctgtggggatagtgagttggggttagtgtagggatatagtcggggtactgtagtggtacaatagtggtacggtaggaatactgtagggttacggtagtttcagaaaaattagttttcagccccagaagtggggggccgcgccggaggtgcggtccacggctggtatcaatataaattatttattttccaggaagccaacgaagctattgatcagagcaacgatacagatcttctcggccagaatgtcaaagtcgattggtgcttcgtcaagggaaagaagacttctggaaagcgctgaaaaccacgtacttaattgtcctctccaatccacgttttatgttt