Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_R09B3.3   

sjj_R09B3.3RNAiJA:R09B3.3
PCR_productsjj_R09B3.3
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene R09B3.3 Source_evidenceePCR363WS150 Sequence/Annotation Release
Chunk_score Abs_score300
Max_abs_score300R09B3.3
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI1191008911910950
Overlaps_transcript R09B3.3.1 Source_evidenceePCR363WS150 Sequence/Annotation Release
R09B3.3.2 Source_evidenceePCR363WS150 Sequence/Annotation Release
WB_DNA_textsjj_R09B3.3862tagcatcgatttcgacagattttttccatttcaagctgaaaatatgaggaattagtccaaaataagaccgcgaagagtgttgaaacttgaattttcagttgtaagctcacattgggctgcgcatagcccaggattcaaaacttgctcgaaccgaagccgttccttcaagcttctagcctcaacgcttgccatcagattgaccccaaatgaagattcgaaataaaaaaatagagcatatatatttatgataacgatttcatgggtttattattattgagatcattaaagatcaaacaagtaacaaagtaccgatatgaaaattagttgtttctgttttgagccaagttgacgcgtagagctcttccgttgaaatcgactccgttgaattggtcgacggctctctgggcagcggcctcctcggtgaactcgacgaaggcgaatccacgtggacgtccggtctcgcggtcgcaaacgattctgaaaatagagattcatattgagagttaacgggtcgtcgttcaggaggtttcgggaagaggagatttcggggagagaagcttacctgacgttgctgacgtttccagcctggctgaagtagttgccaaggtcgtcctcggtagtttggaatggagcgtttccgactgaaaaatgcattaaaattattaaaaactcaaattatctcagcctaatcaaatacaataaatagaaaaacgcctggagaaaaataaaaattttaggccagactttaaattcggcttttctcgattaaaatctgcttttaaagctgaatattccagttttctacttgaataatttacaattaacaaaactaaccgtaaacagagaatccagacatgacgat