Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

Oligo: sjj_R09D1.11_f   

sjj_R09D1.11_fSequenceCTGAAGGACCAGCAATGTCA
Length20
In_sequenceSUPERLINK_CB_II
PCR_productsjj_R09D1.11