Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_R10E11.8   

sjj_R10E11.8 RNAi JA:R10E11.8
Simmer:R10E11.8
PCR_productsjj_R10E11.8
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene R10E11.8 Source_evidenceePCR567WS150 Sequence/Annotation Release
Chunk_score Abs_score559
Max_abs_score559R10E11.8
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII97807689781704
Overlaps_transcript R10E11.8.2 Source_evidenceePCR556WS150 Sequence/Annotation Release
R10E11.8.1 Source_evidenceePCR558WS150 Sequence/Annotation Release
R10E11.8.3 Source_evidenceePCR567WS150 Sequence/Annotation Release
WB_DNA_textsjj_R10E11.8937accagtgacacacagtcgtattgctgcgtttcggtctcaccttcatcgttcatgatttttcatttgtgcaaatcaacttgatatcctatttaacttgttgcatgctttccagcacaactcattcctttctcaatgccttttaacgcgtggctccttggaaaaagtcgatatatcggttttctatttaaagacgtttccattgagtggattgattttaattctgttccttgtaacttcaaatccatttatagtgtgtacgccgttcataatatccaaaattgcattttttggtgatgtttcataatctctgatagttgaccgtttttattagttcatttttcacttattatagaaattaattttcactcagatgtttcaggtatgtcgaccgacactaaacaaatcattgctgatgcgctcttgaagaacgagcaggctatgtatggcccattcttcggcagtcttggagtaacatccgccatggcatttgctgctgctggatctgcatatggaacagcaaaagccggcaccggaatcgcttcaatggctgttgcacgacccgatctcgttatgaaggccattattccagtcgtcatggctggaatcgtcgccatctacggacttgtagttgctgtcattgtgtcgggaaaagttgagccagctggtgctaactatacaatcaataatgcattctcacaattcgctggaggtttggtttgcggactttgcggactcggagcaggatatgctattggtatcgctggagatgcgggagtgagagccctctcacaacaaccgcgcatgttcgttggaatgatcttgattcttattttcgccgaagtcttgggtctctacggtatgatcgtcgcccttattcttggagctacataatttttgcttcaaattgcaattatttatgccacctattaccaattcg