Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_R119.4   

sjj_R119.4 RNAi JA:R119.4
Simmer:R119.4:Screen_A
Simmer:R119.4:Screen_B
PCR_productsjj_R119.4
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSR119.4 Source_evidenceePCR2012WS150 Sequence/Annotation Release
Overlaps_Gene R119.4 Source_evidenceePCR2073WS150 Sequence/Annotation Release
Chunk_score Abs_score1968
Max_abs_score1968R119.4
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI379186381457
Overlaps_transcriptR119.4 Source_evidenceePCR2073WS150 Sequence/Annotation Release
WB_DNA_textsjj_R119.42272attatttagaggggagagggagggggagcaaagtcgctgactgagaactttcgaaaaccggttagttactccagttgtacggcttattcatgccatattttccaagatttccaccattgtgttggtattgagaatgttgattctgctgagctgccggcttcgatccagacatcttgtcgtaactcttgcgctcgtcatcctgtccgtagagttgacgacctccagcgctgcttccaacattgggcatcatgttcatgaatggagtaaactggtgtggagcaggtgagtactgctgcatgaacaacgacgacaagtttggctgctgcatgtagttcgtcgcctggaaccctggtggtggtccaacattcgacgcctgctgtggctgctgatcccgagagctttgagatccgaacttattgaagtccataagtccatgagtctctcgttgttgaccagattgcacttgttgcgcagaagcagcctgtgacagaggagcagttggaagcaagcttgtaagatcaactcccattccgtattgcataagagcagcagtatattgctcatctcgaactcctggcattggattgtacatgttcatgtagttgttcatgtatggtgcatatgggagttgttgagtgaacatcatatgtggatgctgttgtggatgtccagtcggttgtgattgagctggtggagtttgttgctgctgctgcactggctgttgtggggcttgttgctgctgctgctgtggctggtgctgctgagcagattgctgtgttggaagtggtccagaattgttgaacttgttcggcgccatcctgtccgttggttgatatgaagcggacgaagtgtcataggacaatcctctgttagattgaccatatgacaatggaggtgaagtcgattttaagttgtaatcgccgttaggaattgacgtcctttctggctgaaaaataatcgagaattagaataaatcgtctttgcaacaaatttaactcacctcaacttgtttcggcataatacgagaagagttaaatatattttcactggcatttgagatcgaggcagcggaggattcagtagaaggaagctgtgggcttggagcagcctcaacaaatccaaatgagtagtcatgaatgttcgttggtgcagttgtgccaacaaattccactccaggatcaggaataatctggactggtgctgcacttggaattggagataatcctagtcctggtgcttcactcaatcctattccaagatccgtcttcagttgagtggtccatgcttgatttggttctggggtgctttgtacattttcatcgtgatgagtcgacacattaggcgtctgctcctcagccaaaactgatgattcactgaaaattaaatttttaataatctaaatacagggacagaacaacttacttttggaagaaaccatcttctttctccggctgatgcgaagtttctggctcgaaaaatactggcgctgctgctggctcttctttaactggtgcaactgacggaagtggaggttgtggggagagactcctccttggcggagctgctggttgaggattctgtgcctggtgctttcggagtgcttctttgcgatgggcagctgctgctactgcagcaaatgagatcggtgccggcgcagaagatgtgggaacagtggcggtgacggattcctctactggtggttgaacttcggtgactgtggtatccactttagtctgattctgaaaaaaaaacacgtttcgtcattttccttcttcaaaaaattcttacctcatcaagatcagcagtgaacgcatctggctcaagtgctgatgatggagcaacagctcgagaatatccacctctggcgccacctcttccacctcgtccaacatacggtttttcaaatcctcctcgagtcgagcgtggtgctgctccttccttattatcacggttatcccgattattatctcggctttctcttggagctccattggatcgcccgcggcctcctcgatcgacgaaaccggtgcctccacctgaaaaaaacatatcaatatttgatctatttcaatcaagcacgaacctctgcctcttgctacaaatcctctgttgttataactgccctcttccggcttcttcttttcctttttggctcctttctgttcagtccacgagtcaagtttatctccagcatccagaatgtgatcgattgcgccgtaaagattgttgtcagtatccaatagcgctatctcagcttgtgcttgtgtacatc