Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_R119.5   

sjj_R119.5RNAiJA:R119.5
PCR_productsjj_R119.5
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSR119.5 Source_evidenceePCR938WS150 Sequence/Annotation Release
Overlaps_Gene R119.5 Source_evidenceePCR938WS150 Sequence/Annotation Release
Chunk_score Abs_score833
Max_abs_score833R119.5
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI392445394500
Overlaps_transcriptR119.5 Source_evidenceePCR938WS150 Sequence/Annotation Release
WB_DNA_textsjj_R119.52056ttcaaatttcttacggtcttggatcaaaaagttgtcgacgccgattcaactcttcgaattgttcagcttgatgcctttgaacatgatccatatacgtatttccacctttcatcaccattattgatccgcaaatctgacgattgacacgtggattgtaggcgtgtcggcgaatgtcgcggcggagtgcctgacgcgccaagtaggtcaacgtgcggggaccactaaaaaatccgggttattgtgatttcgtggtgagacccgaaaatagtagaatttcctcgtacatcctgtgcctaagcaggttttcagtttttgatgggttgttaccttcatacacctacctgcctttgtgactgcctccctgcctgcctaaatgtgtgtatgcctacctacagtctgtttatctgcctcaacgccttcatacctacttgcctaccttgcttacatacctgcctacgcgactacctatcggcctaccggttggcaagtaggaaggctaacaggtaggtaagctggcaggcctgaaatttgcaatttttgcgaaaaaccgaattacctttcgaaaggcgtaggcgttgagatccgttcctccttcggaagcctgatcattggagaaaatgtcattcttccagggacgtcatacacagtacgatgcttggaaactcttctgtatcggcaaacctgaaaacctttaaatgtggaggagccaagaactagacggagcctgtgtaaggaatattgtttccggaaacacggattttcaaattttaggctccacccactcaccacgcaaaatttcatttttggcccaaaaagtaaatgtgcagaaattgtatttcaaattgtagaaaaaccaagaaatgggtggagcctgcctgcctgccgggctccgcccacttcttgccaaaccataccccctgtatacgtggcatgacgagttgtcctccaacattcaacattccaagcattcgtttcaacaactgagaatcatcggcaacgaatccgacaaaaattcgatcatatcgattttgatgagcttcaagaaatttgacatcggtgatgtcgcacactttgagctccggccgagcccagccgacagagctcgcttcgggtgtagttatccattgatcaatgcatgtttccgagtaggtgacgagattctcgtagagttcgatcccatgatttataccagtttcaccttaaaaatagggttgtcaggccacgcccatttttaaaaaatgaattaaaattttctgagaaaaaatttcaaactttggtggggcattaaattttttcacataaattttttcggcggtaaattcaaattttttaaaaaatttcttttttttttggcgggaaatgtgccgcaaatcagaaaaactgaaatttctacaaaaaaagttggtggccgagttttctcattttgtggtcagaaaactcggccaccgatttcttttgcggccctgtgattacttaaaaaaatcggtggccgaggatttttattttcgcggccacaagtaatgaagattgcacaaaattgataatagggaaaacgcggccacgaagtctaacatgtgccacgtggccgttaaaaaaaagccggtggccgagttttattatttttctaggccacgtaaccagaactcacccaataaaatgccagcaatcgtacttaaataccctgaaccagttccaatatgaagaaacgagtgtcctttacgcaaatccaaataatcgaataatttcgcataaatatcaattgctccaacacgaagtgctcccggatagaatggaccgcccggttctgtggaggtcaacgacggaagacgtgtaaatttccgttcactaatcggaagaaaatcggatcgatcgacaagtcgaaaggctcgttcgatgtttcgacgacggattgtgtcgttttttacgagaaaatcgataagatcgtcgttttggctttcactattgcccatttctggaaaatcgattttttaaaattttagatttatttattgattttaaataaataattagagagcagtcatgtgtttttccttgt