Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_R11A5.3   

sjj_R11A5.3RNAiJA:R11A5.3
PCR_productsjj_R11A5.3
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSR11A5.3 Source_evidenceePCR468WS150 Sequence/Annotation Release
Overlaps_Gene R11A5.3 Source_evidenceePCR525WS150 Sequence/Annotation Release
Chunk_score Abs_score483
Max_abs_score483R11A5.3
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI78628537863700
Overlaps_transcriptR11A5.3 Source_evidenceePCR525WS150 Sequence/Annotation Release
WB_DNA_textsjj_R11A5.3848attccacaggaattagttgctcacgcgggatcataagatcataacaatcattctcagaagcacagtggtggtcgaacagccatcaaattccgcacaactttccgggtctcgacacgatgttgtcgaactggagccaatgatccaaagctttttcttctttttggagtcgacattgctgcgtttcctccagtgctgtgtctccggatcggagcagttttaggtgtcattggtacattcgcaagctttattgatcgacgtcttggtgtctgaattatcttttttctatccttttttgttgttttcatgatgacaaccacatcgaattctggtgcacggcgaagccgagaagttgttggtgcatttgtgatttcttctggtgctgaaaatattaggtaaaaatgttacaaatcaaattaagaatgagtatcacattactttagtggttatttccactttactgcaaattttcaattgaaaaacaatacaaataattacagtataaaaatcgtttaaaaaactaaccaattctgtgctcaggtttatccttaattggtgcactaagccttttcttgtttccctcaattggtcttttgatgattccatccgatgcttgaatgccatgtgaaattgttggtctcttgactggagtcattgggtacgacatttttcagatagactgattgaatgaatgactggagtgtattggtaagacctgacttatatatgagttggcggtgggggcggggctacaaggcaggatggtccagaagggcggagaactttctggaaggaatggtatagatgagaggggcgggggcagagtgaggtccctacaaacaacaaaaaca