Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

Oligo: sjj_R11A8.2_f   

sjj_R11A8.2_fSequenceTGCGTCTCTTGCATTCAATC
PCR_productsjj_R11A8.2