Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_R12C12.8   

sjj_R12C12.8 RNAi JA:R12C12.8
Simmer:R12C12.8:Repeat_a
Simmer:R12C12.8:Screen
PCR_productsjj_R12C12.8
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSR12C12.8a Source_evidenceePCR769WS150 Sequence/Annotation Release
Overlaps_Gene R12C12.8 Source_evidenceePCR836WS150 Sequence/Annotation Release
Chunk_score Abs_score689
Max_abs_score689R12C12.8
Specificity_index0.617
Rel_score1
Map_statusUnique_ePCRII60585596060521
C25H3.8 Chunk_score Abs_score428
Specificity_index0.383
Rel_score0.621
Overlaps_transcriptR12C12.8a Source_evidenceePCR836WS150 Sequence/Annotation Release
WB_DNA_textsjj_R12C12.81963attaaacatcttcgacggctgtagtgaaatgaacttcacatcccgttgtattcttcatcacatatggcaaatgatcactactcgatcgagtacactgatttctgaaatcgtcacgttcgaaggaagcaagaatagccggaagtttggtattccattgaatggattgttaaatgagctgttcggtaacattgatgttcagagtactcttcgtctcggcgacccattcgatagtctgtttcaaatcctttttattgtgcaggaagcgatgaattttccattcttcaatgacaggttcccatccgaatattctttgattgaaataatccattgaaacatggaatgaagcaatgatccgttcacccgtctttttcaagcaaacatctgaaattgggaaactaatttagacataaacctttaaaatactcacgagcaactgataatctcaacaaaggaatcgagttggactgaagatcgtcgagaatccacaaatcagtgtgttcagtttgaatcatgtaaatcgcaatgtcaattgctgaaaatgttaaatatttagtctactggaactgattctggaaaaatacgtttagatggtggttgtggaacattaattggaatcaaagacttcttctgtgcttctttataattctttatccttgaataactgccttcaaagcacgagcatccttgtacgacaatcggcaaatcattttgacaacttcgatctgaaacacagtagatattgaaagttgattaaaaattaaaaatcccgtaaaacatggttgtaccaaactaaatattagacattttggatggacaaggattaaaaattcaaaaacaatcgcccgacatatagaaacgaaaaaacacgaataccgtagccatcacatttttctacaaccctctattaagaaagtagttaaactttgttcctgtattaaataatatattggattttcaaactaatatatatttagttattaaattttaaatttacctccaatgcatgccgtattggtggtgttacaaccattcccttattctgtttcgattgatttccaaatgaagatgtatcaatgtgcaatgcaatagttatcgagaaatcatttgaacataaatttctcgtttgtttctcatgttgcattgaacaccatcgaagcttcattgattgaatttccaaatttgcagaaatatatccaccattatcattcatattcaacacagcagaagttgacgctattattgcaactattttttacaaacagattctccagtagataaagatcagaatctcgatgtgtgatcttaaatgaaaacgttgggaaatgagatgacgctgaatcagttgcatgtgcatttcgttcgattatagctccatcatgagttttcgaaaatgtttgacgacgcccagactctgtgaggtgatatggaatctcatcggaatctgcaaaaaggggttttcaatggaaaagtatatagaaaaacttacattttggaacaaaatcggtataaaggttcaagaattgtttcagatcgtcgagccagtcgtaggcaagaataacacgggcgttacagagaacgagtgttagaacgggacattcatcttttttcatcattatatgtgcttcaagcatcagagaagaattaatagaagatgtgacaggagttgctggtcgagaactgcaaaaaaaataattgtgtaatattttttcataatatctaaatccgaaaaatttctttttaaaaaatgatacctggtctcgacacgtttttttttgtaaaataaaaacgagagtgcgttaaagagtactgtaattttacaattttgcagaattttcatatgtgtaaaaaaattctctttttttaattttcttaaacaaatttttatagaaaacttatgacaacagccattaaaatttgaaattacagtaatctttaaaggcgcacatctttttgcatgtaacaa