Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_R13F6.1   

sjj_R13F6.1 RNAi JA:R13F6.1
Simmer:R13F6.1
PF:GL1_4F4
PCR_productsjj_R13F6.1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSR13F6.1 Source_evidenceePCR450WS150 Sequence/Annotation Release
Overlaps_Gene R13F6.1 Source_evidenceePCR500WS150 Sequence/Annotation Release
Chunk_score Abs_score416
Max_abs_score416R13F6.1
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII68694746870297
Overlaps_transcriptR13F6.1 Source_evidenceePCR500WS150 Sequence/Annotation Release
WB_DNA_textsjj_R13F6.1824tcgaacgttccaacaaataaaattatcggaaaatgtctcatttatgatttttttaattttcaattggtttgaaaatgttgtttacttttttccagagaaatgacaactccaagtcctcaggaaatatcaactgtcacattgaactctttgtcgaaggaagaacgaaagaaaggtgagtttctgaacagattaatcattatttattctgtttttagcaattctggccttacaaacaaagaaaaacgaaatcaaattagttattgatgaacatcagaagaaattagctgagtttcgacaatcgattcctgatgggtgctgtgaaatgttcgaaaacgaaaagaaaattcgtctgaaacatagtgtaagcttttttactcaaaaaattgcttctaaataaattcgaattttcagtccacggccgaacttcttccacatttacaaaaagtaggctcgagcagtgtcgacaaagagaaaatgatcaacaacattcggcaaagagttgaagttcaagttgctgaccaggagacttttaagagtatcgaagaacggaatgaactggtagtataataaaaatttgtatttcttaaaataaatatactgatttcagttgcgtcgagaaaacgagaatctcaaaaaagaagtcaataccgtggcagccgaactcctgcaagaatttgaaagttatgaataaacttgtgaacatttattttcgataccacgtgtatttctcattaaacattttcatccacatttttattgtatcaattcatttcttttaactctctaataaagatcatgggattcaaaaaggatgtgcaatttct