Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_R13G10.1   

sjj_R13G10.1 RNAi (3)
PCR_productsjj_R13G10.1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSR13G10.1 Source_evidenceePCR836WS150 Sequence/Annotation Release
Overlaps_Gene R13G10.1 Source_evidenceePCR836WS150 Sequence/Annotation Release
Chunk_score Abs_score773
Max_abs_score773R13G10.1
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII38186893819784
Overlaps_transcriptR13G10.1 Source_evidenceePCR836WS150 Sequence/Annotation Release
WB_DNA_textsjj_R13G10.11096agtttggaaattggtgcgacaaaacgattggttccaacaatatcctcaatatattcaagcattccttcttcattcggatttttggatgttggcttcattagtgcaatcgcttcaacttctccttgcagaatcaggaatcgattatgggtcatatcaattccagcacgtaggagaagctcctggacgtctttttgcgatgcatctttgtcatcaatacgatattttgaattgttttcacgatttattgtgcgggtgatgcagacgcaattatctgttaacacttcatatttatcgtaattttcgacaggctgaaaattaattttgatattgatagttattagtttgttttcaatcgtgtggatctcaggcccgctttaataacctacttaccatatccttcaccatctggaacataattgttactgaacatgattcgtagttccctcctgaattgatcaatgctgatagcttcttggtacgaatttttccagcctgaaacaatgtatattgtggaataaaaatttcaatttaaaaaactcactttaaatccaaacacgaatagcaatgcatcaataacgtttgactttccacttccatttggtcccaggatcattgtcaagttcttgtgaaacggtccgagaatatgttttccagcataacttttaaagttctcaacgtagatattcagaattatcattcgatttccatccggatccgagatctgatcttcatattttgggggaatttgaacattcaaaagatcctctttttcatcatatttcacaccgttttcagccgcttcaagttccaacatatacgcgcctgaactaacatcatcgaatatgttgagctgttccatgtactgtcgtcggcgatccacgtcgagatcgacttcaggcatcgagtcggtgtcagcatatggtctatcatcgtccgaggttagcgcccgtcttttaaacggctgcatacctgaaaaaaggaattaattttgataaatattaaaagggagagggagagtaagaggtgcataattttgccaaaaaggcaaagctttggaaatgttttgacaactggcaaactttcgaccccttccaat