Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_R13H9.2   

sjj_R13H9.2RNAiJA:R13H9.2
PCR_productsjj_R13H9.2
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSR13H9.2 Source_evidenceePCR384WS150 Sequence/Annotation Release
Overlaps_Gene (31)
Overlaps_transcriptR13H9.2 Source_evidenceePCR429WS150 Sequence/Annotation Release
WB_DNA_textsjj_R13H9.21107cattcttcactactttgcgatccggaaatttgctcgtaaacattttataattttttaaaaatctttttgacacgttgcgttttgacagttcatttgaaaaattaatgtaacatttttatatattcacgtgatctcctacttttggatgaacttttagatctaggacagagataaaaaggatgctataaattgagaaggttttgtcataatcttcactgcgagttctcataactccttcaacaaatcgccatggcccaatctgtcccaccaggagacatccaaacccagccgggtaccaagattgtgttcaatgccccatacgacgacaagcacacctaccacatcaaggtgatcaactcatcggctcgccgtattgtatacggtatcaagaccaccaatatgaagagacttggagttgatccaccatgtggagttctcgacccaaaggaagcagttcttcttgccgtttcctgtgatgcttttgcctttggacaggaggataccaacaacgatcgtatcactgttgagtggaccaacaccccggatggagctgccaagcaattccgccgtgaatggttccaaggagacggtatggttcgtcgcaagaacctcccaatcgagtacaacccatagagctctgtgccgttttttcaataaatgaattttgaaagattgttgatttttctcttgtttataattttcagatttaaaaacgtatcaaatttgagtacaacccaaagaaggcttgataagaaggttcattttattttaataaagtttctttgaggaattgatgtgttatttgtaactctgtgtttgcatcttttgcaacacacgacatgtttcatccgtttctagaaagtagagagctgtagctatttacctcattcgttttcaaagtgttggaagttacggcaatacggctgttaattacccaaagttttacggttgggtaatgcaaaattgcttaattaaactataaaactttgggtaattgacaggaatcaatccacctccactgtcaccatggaaatatattctcgaaacgattttttaggatcgtatgcacagagaaaaaatatacagtattgtttttgcttcatcgga