Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_T01G9.4   

sjj_T01G9.4 RNAi JA:T01G9.4
Simmer:T01G9.4:Screen_A
Simmer:T01G9.4:Screen_B
PF:GL1_2E6
PCR_productsjj_T01G9.4
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDST01G9.4 Source_evidenceePCR855WS150 Sequence/Annotation Release
Overlaps_Gene T01G9.4 Source_evidenceePCR855WS150 Sequence/Annotation Release
Chunk_score Abs_score771
Max_abs_score771T01G9.4
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI82921038293300
Overlaps_transcriptT01G9.4 Source_evidenceePCR855WS150 Sequence/Annotation Release
WB_DNA_textsjj_T01G9.41198ttcggtaccacacgcaataagatatccggctccgatttcccacagactataaaaaatttgtgaagttatattttaaaatgttttttcagtaattagaaatttcaaaaactaacggagaatgagagataagaacactggcgtagtccaacatgtgcattttcctcatcacttcaaactcgggatccaatgtggatttgtgaataagatcaaccaggtgaactgcgagccagggattcgaggcaatcaactgaaattttattcagtaaaattaattaattcttatttaaaacaatctagaatttattttgaagaaaattgttaaatattcttgaacattattttgatttttttttattgggataaaattgaatgaaatgttctgtcgccgtttaattaatcgtgaaagaaatagtgagcctattttcaagagatatttatatttaatttaatttcttgaataaaaacaagaacctgttgaaagttaatatcatccttcgaaataagacaccagaatacatcattttcctttgcaccctcctcttcctcttctccaacgaatagtgttctacactcatcagctagctcaatgagctcgacatgtccggcgaatggattcttgacaagcacaaagaatggcagaaaatgccaccacgtgtcgaaaatccgtgaagccatagatacgaggtatcgttcctcaccgagtaggagcttcgtaagatatttgaaattttcgttgctcccgtacttcccacttgtcaaattttcacgcatgatatccttccattcatttactgtgttagcctgaaataagaatattacgaagtttaagaattattatataaatgggtcttactaatgcttcgtcgactaagttttcgggattgaagaatgtgagagcctcaatgaatgcatcacattctgatccgcctccatgtagctccaacagttcaacacaatcgctgaaattgcaactaagcaagctgactgctactcccttccaatattcttctggaatcgtcttccccggatgcagatattccacagctgattccatggctcctctagaaaacgtgaagctctgattggcccatgaaataagatccgcacatatcgagctatcacctcttccaaaccataatttctcgtaaagtgaccacaaagcaaagtctgtcatgaagtcggaactgctgtgagacac