Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_T01H8.2   

sjj_T01H8.2RNAiJA:T01H8.2
PCR_productsjj_T01H8.2
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDST01H8.2 Source_evidenceePCR724WS150 Sequence/Annotation Release
Overlaps_Gene T01H8.2 Source_evidenceePCR724WS150 Sequence/Annotation Release
Chunk_score Abs_score619
Max_abs_score619T01H8.2
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI85723138573799
Overlaps_transcriptT01H8.2 Source_evidenceePCR724WS150 Sequence/Annotation Release
WB_DNA_textsjj_T01H8.21487gtccaactcttgctacacgaactccatcagcaattgtatccaatgtgtcaaccggacacttaattccattttccagaaagttcgaaagttctttctgtgctggttgcacaaggtatactataaatgtagatatagtaaaaacaagtgacaatgtgatttgacaaaccttcgatgtctggcctcaagttgcctatcagaaaagcaacagatgaagctaaaccaccacctccaacagataaaaaaatggaatcaatctcattgccaacctgttccaggatttcaaatgcaactgatgactgtgtggaaaaagaatattatttagttgttttattaattgaaaacaacttacatgtccgttgatcattgaaacacaattataaggttctacacaataatactcaagtttttcagtcaaatcagcacatacagattctctggaaactgtaatttatttgtgaagttaggctgataaagaattagattttttgtaaaaaccggaaagataaaaatcaactttttaaaatgcaaattcctatatttttccagattgatttcatctaaaatggaaattgtgagtccaatcagcgtttttctccgcccagtctcgaaccaattagatgaaatgggaaacgcgttttaaagtaaaatccctagtttcttataaaatttctaggctcaccgactagtaacagttggctcacagaaaacaatattcgcattgtattctctcattccttcaattttagaaattggagcattttttggaacgacaattgtacaaggaagtccgattttttgagcagcccacgctagagcttgcccgtgatttccagacgaatgggcaatctaaaaattgaaatttttggactaaaacgttttctaataaagattcacttattcagttacaagatttagtaaaactttcacctatcttcatttcggaaatcgaccaaaaatttatcttctacagagtttatgaaattatttcttttcaatttattgtatattaacattctaggaattcgaacttgcagcaatgctcgataaatccacatttttgaaaaaattggcagtttttcaaaactttgactgaaaattttggaaaatatcaaaaagtttaaaatttatggagcaacatctgggaatcagattgtaaaattgaaaaaatatttttgctcatatgaatcaaaaaaaaaacttaccattccttttgcatttttctcttttgccaaaatagcagaattcagtgctcctctggctttgaaacttccagttttttgtaaatgttcacatttgaatagaacatgtgttccatttccaactttttcatcaatattttcacttgttataacaagtgttttatgaagaaatggagcagttctttgataagctgctctcatttcttccattgttatttttgtagtcatggctgaaaattggaaatacgaaaatgaaaaaaaattaagttcaccgaatcagaaatcaaa