Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_T02G6.6   

sjj_T02G6.6RNAiJA:T02G6.6
PCR_productsjj_T02G6.6
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDST02G6.6 Source_evidenceePCR731WS150 Sequence/Annotation Release
Overlaps_Gene T02G6.6 Source_evidenceePCR731WS150 Sequence/Annotation Release
Chunk_score Abs_score668
Max_abs_score668T02G6.6
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI1182130211822992
Overlaps_transcriptT02G6.6 Source_evidenceePCR731WS150 Sequence/Annotation Release
WB_DNA_textsjj_T02G6.61691gcccataccttgtcttggaacattctgaaaactgaaattcaaattgttctaaaattcgacggatttaccgaccggatttgcttcaaaccgcttgaaaattgtcatacttcgaatgtttctcaactccaattttcagttcgacgtcgtagagcatctttagacattttttgtatcggaagtgtaaatgaagatagtagcattatcatgcacaagtgctcctcaattcttctggaattgttgcgtgtggaggattatgagttacgcctggagtgttcaaaaaactttgatttgtcacatttttttgtatggaatttcaccactcatttttcttttgtagagtttagcccgacaaatggagaagacttccataagctgacttttctacaaaaccgtgtcaccactgatattctccaactgagtcagtataaaattgataatgtataccacagaaaacaaatccaactacctgttttaacgcaaagctgtgtgaaaattagtttaatgaattttggagaaatatcgaatctattcaaaatggaagtcaaaagattggaggtatacaaaaattgttccataacttgcaaaaaaatcaacgaacttttcaaacactggataagtggtggaatggagcatctggaagtgttcaccgccgatcaaggattttatgatactcacaagcttttagaaggaatcgagatggttgatctaaggttagcatttctaaaagtttttaataagaggtgggtacatgtcaggggtatgcggcagatctccgaatttgtgagcacggcggcaaatttggcaaacttgccgtgctccgaaaagtttgattttttggagcaccaagactactctggtttctgaacaagttccgtgtagtgtgtctgcttaaacatcaaaataactaaattttgtgtcatttcagtcaattgtcagaaccaaaatcaatagtttttaggtcaaaattgtattgacaaatttttggtgtgtgcggaaaatctacttttttgaaatttgccgaactcggtaatatcggcaatatcggcaaataattttaagaggtccctgtagttcaaactacatagttcaaacagaaagccaaaaatttaaaatttacagctcacacagacctgcacacccggattcggattttatgtctatgtgtgaaacgaagaaatgtgatattcaaagatcagtggatggaagacgggcaaccatatttcgagactgcaaaaaagttagcttgatggtgtggccggctgatataacaagttgaacagtctattttgtcatgatttttatatttttaaaagatattctaaataaacttatatatgctttatcaattccttaaatactacctctacggatgcgagacggcacgtggtgtcaggctgtcccatcgctccaataaaggcgggaaaatatttcttgaaaatttgtgacgtcatgaatattcaatttttgccaccactgaccctgttgcatagagatggttctcataacttctcctgttaaatttcaatgatattattttacattattatattttcttttctaattcctaatccggaatcttgcttagttgtgcacaacttatgtaagttttcttaaacctattctacataaacccaatttctcatagtatcaactccttgtgctggaacttggacagcctgggcaaatgtaac