Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_T03F1.1   

sjj_T03F1.1RNAiJA:T03F1.1
PCR_productsjj_T03F1.1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDST03F1.1 Source_evidenceePCR1050WS150 Sequence/Annotation Release
Overlaps_Gene T03F1.1 Source_evidenceePCR1056WS150 Sequence/Annotation Release
Chunk_score Abs_score993
Max_abs_score993T03F1.1
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI38743673875519
Overlaps_transcriptT03F1.1 Source_evidenceePCR1056WS150 Sequence/Annotation Release
WB_DNA_textsjj_T03F1.11153gccaagatgagtgatgagcaaatcgataaactcgtcagccggctagatggtgctttaaaccgccttggaaatgttaagaaagaccaccctctggagtcgtcgtcgaactcgaaaccaactcaccagccaaagtctccggctccttatcggcaaaaaatcgagaagctcagtgccgaagttgtcgactcgaacccatacagccgacttatggctttgcagcgcatgggaatcgtcaatgagtacgaaaggatccgagagaaaacagtggcagttgtcggagttggcggcgtcggaagtgttgtcgcggagatgctcactcgatgtggaataggaaagctgatccttttcgactacgacaaagtggagatcgccaacatgaatcggcttttttatcaaccgaaccaggcaggtcttagcaaggtcgaagcagcgagagacacattgatgtaagaattttcctctaaatcgtttttttttcaacaataaattttcagccacgtcaacccggatgttcaaatcgaggtccacaacttcaatattaccacaatggacaattttgatacatttgtcaacagaatccggaagggatcccttaccgacgggaaaatcgatttggtactgagttgcgtggataacttcgaagctcgaatggctgtgaacatggcttgcaacgaagaaaaccagatctggatggagtctggagtcagtgagaatgccgtgtccggccatattcagtatatcgaaccaggaaagacggcgtgttttgctgtaagtgaagtttcatccttgaaatcaaaacaaatgttcattttttcagtgtgttcctccactcgttgtcgcttcgggaattgacgagcgtacgttgaaacgcgatggagtgtgtgctgcgtcacttccaacaacaatggctgtagttgctggatttttggtgatgaacacgctgaaataccttctgaactttggagaagtctcccagtacgttggatacaacgcattatcagactttttccctcgtgacagcatcaagccgaacccatactgcgacgactctcactgtctgcaaagacaaaaagaatacgaagagaaggttgccaatcaacctgtggatcttgaagtggaagttccagaagaagaaaccgtcgttcatgaggac