Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_T03F1.9   

sjj_T03F1.9 RNAi JA:T03F1.9
Simmer:T03F1.9:Screen_A
Simmer:T03F1.9:Screen_B
PCR_productsjj_T03F1.9
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDST03F1.9 Source_evidenceePCR1070WS150 Sequence/Annotation Release
Overlaps_Gene T03F1.9 Source_evidenceePCR1070WS150 Sequence/Annotation Release
Chunk_score Abs_score1028
Max_abs_score1028T03F1.9
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI38639423865063
Overlaps_transcriptT03F1.9 Source_evidenceePCR1070WS150 Sequence/Annotation Release
WB_DNA_textsjj_T03F1.91122actcgattcacagaatcaacgatatccatcctagtcggtgttgagagcagtgcagcccgagcacattcgacattgttggtgggtccaatattacggatagaattatccgtgtgccgaatcgatctggaaaatggagaaataagaataatattccgcaattcgaaaaaaaacatactttggagttgcggctttcgatacatgcattggctccactttttctggaacttctggaaccggcgaaactcgagatgcattgaatgttggagagatataagacgagccaatagaatccgcttccattgttcgttcttcagctaccgattccatctcaatcgttcgctccttattcgattcagtactaagtctgctggttgccttgattcgtggcggcgtttgaaccaccggtctgatcttttttcggggatgtttgaagaagttggctcccggcgattgaatttcttccttttcgagcatactgttgtgaagaggattagaaatactggcattacgtcgttctcgctcatccgaagtgactttcgacgttctccgtttttctcctccttccatcgtgttttgtgccagtactggaggcttcacaccaacactcgtggttccttgctcgtatgcatctctttcttcaataataaacgtcttttgaagagttgaatcgttattttcatctctgttagctacgttgaaagttctttgaagtgatgactcatctttctcggtcggctttgtgaacgttttctgtagagaggagtgttctgcatctttagccactgtgaccgttccctgcatttccgagctctgattcttctcgatcgtcaccgttttctgaagttcttcaggagcatctttagccaccgtgaagtttccttgcagctgagagctttgattcttctcgatcgttaccgttctttgaagctgtgattgctcttttgatgcatctttagccaccgtaaacgttctttgcatttccgagctctgattcttctcgattgtcaccgttttctgaagttcttcaggagcatcttcagccacagtgaaggttttttgcagctgagagctgtgattcttctcaatcgtgagagttttctggagtgttgactctctctcctc