Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_T04C10.2   

sjj_T04C10.2 RNAi (7)
PCR_productsjj_T04C10.2
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS T04C10.2a Source_evidenceePCR524WS150 Sequence/Annotation Release
T04C10.2b Source_evidenceePCR524WS150 Sequence/Annotation Release
Overlaps_Gene T04C10.2 Source_evidenceePCR537WS150 Sequence/Annotation Release
Chunk_score Abs_score495
Max_abs_score495T04C10.2
Specificity_index1
Rel_score1
Map_statusUnique_ePCRX1481784014819016
Overlaps_transcript T04C10.2a Source_evidenceePCR537WS150 Sequence/Annotation Release
T04C10.2b Source_evidenceePCR537WS150 Sequence/Annotation Release
WB_DNA_textsjj_T04C10.21177tcggtgacatgatgacgattgctgcgacgactttccgctccaaccggtcctggattgttttgcttgaatttgtttcttgtgaggatgaagcgtgttctttcgtttttcaagcgttcatcgtcggagagcagtgaagtgatctgctttgctttctctcgaatgttcaagccctgatcccgattgtcttccacatgctggaaatccttgagtgtttcaatggtgaacacgttctctctgcattgttgcgcgacctgcaatgcgaaaaaaaatcgataatgcatatgagtcagaaaaccattaccttctcgtggccgcatttgatgagaaaatcgagaagcaccagacttttgtacacgtgtcgccagtttttgccagaatcatttaatcgcttccaaacaattgacataatctcagtgaacgccattggattgtgcgtcaagtcggcaatttcggacatgagcgctgtggatggtccccatggatcgttgcttgtggcttcgcgaacctttacttgtgcatccgagaaattataggcgacgttcttcacttgccggcgaatcgtcgaaatcgacatgtttgctccccgcctgaaaataaaaaaagttaaagagatgcaaaggcagaaatcaaaattatacaacgaatgaccattgactgaaaaggaaacatcacatggataagattatgcccaatcaaataaactgaacagagaactacaaaaatgccaactggcaagagggatgatgtggctgaatggtgtggctaaaacatagaaattgataagaaacgatccaatagaatcgcgcatgtacaatgcatatttgagagagagagaaaatgaaagaaagacagagaggcgaatgagtgaggtttggagagggtgagtcttttgtgagtgaatatatatgtgtgtgtgtgtgtgtggtctttttgcgcgcgtcgcatgcgttttgtgtctgtgtctgtgtgtgtatctgtgagtgttgagtgttgagcgcgagagtatttctcctcgaggcgaacgcgcgccgcgcgcgtgcaacagcgcacagtgagcgcacgagtgtcagtgcgcgtgctagagagcaccatttgcagtgagacgcagatggttagaagtgtcccccagagaaaagagtgcgcagagaaaaaggagccggatagtgcgagagacaca