Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_T04D3.3   

sjj_T04D3.3RNAiJA:T04D3.3
PCR_productsjj_T04D3.3
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDST04D3.3 Source_evidenceePCR768WS150 Sequence/Annotation Release
Overlaps_Gene T04D3.3 Source_evidenceePCR768WS150 Sequence/Annotation Release
Chunk_score Abs_score726
Max_abs_score726T04D3.3
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI1331257713313747
Overlaps_transcriptT04D3.3 Source_evidenceePCR768WS150 Sequence/Annotation Release
WB_DNA_textsjj_T04D3.31171tctcacagttcacctgacgccacagctttcaaggataaatttgccgcgagtactgtaagtccaacgaaaagaacaaccttatgaatttacgtgaaggttgcttttaatgtgaagtgagctagattgtttttcaaggcctggcgagatgtcgacttaggctgtctctagagcaataggccgcagcttgggcaacgttggcttggtaggtaggttttttttaaattcctactggtctaagcatcacagaaaaaattgattccttcagcttagcctagtctcaaaactgaaaaaatcaacctacccctccggcaagctcagcatggacttcatcgtctttatctgcatgaaatgagttgacatgtcggttgccaagacgatctcaatgaccatattcctcaactctttatactcatctcgagtcaaatgagtcaaaatattcttgtcatcctccttcatcaaccgaaagcatgatgaaacgtggtgattctccaagacgcttcgatcgttgtaaagcattgcaaattgggattgagattggatgtggaaattgttggtgtgtccggtatgctcgtagtcatggatgagggctccgaagagcaccgcgagaagttccaagtctccgagcgaattctgaaaaacttgtgaatggctttgtcggctgctcaggtgtcagtttcaaatattacatatcaatcaacatagggaaaccttcattgtctaaagaaaacctaccgccaatccagtttgcgagagcataaagtgtgagctctgagtgacgtcagctgcatgaacaacattgtgatatggattgttatgttttgaatatccaacttccaacgcggataaataattctccagtgctgtcaacggaaccttgaatcgatccataaatccatatcggttgaataattcgaatccaacgtatttcaacgcgtgaccctcggagacttcatttaactggaatggactgaacgaccacgtgcacacttccttcataagttctgcgatttcaggtggaattggacattgaacaacttgctgttttctgaagagcttctcgaagaagattccggttcgaatcgcgttggcaacactcttgaactttggcttatcccttttttttccggcgttctggcgagtgaacgttgcagcaagccactcacgaacttca