Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_T04D3.5   

sjj_T04D3.5RNAiJA:T04D3.5
PCR_productsjj_T04D3.5
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDST04D3.5 Source_evidenceePCR735WS150 Sequence/Annotation Release
Overlaps_Gene T04D3.5 Source_evidenceePCR739WS150 Sequence/Annotation Release
Chunk_score Abs_score697
Max_abs_score697T04D3.5
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI1332992013330746
Overlaps_transcriptT04D3.5 Source_evidenceePCR739WS150 Sequence/Annotation Release
WB_DNA_textsjj_T04D3.5827aatgaaattaaattcggagcgatttcaagtttttcctcaccacttcacacgcctctttgaactcatgtggatccgtacaagttctgagcaacgctgcaatatcctccgacaagagcacattattctgaagcatacggaccatcggtgtaagcttctcatcccaatttccatacagacactcgacacgtttcgccaccttctcagcccacttctccgcgacatcagtgataagtgcgtcgaaaatcgtacgagatgggaagggtccacgccagcattcctggcacttgattacgtcttcaatcgtgtagagccgatgagttggctgagctctgtagcagaatgagcacaccattcgttgaagcttctcgtctcccagctcggcgagctcgtgctccataacttgacgaagtgttttcatatcgagtttcgcaggtttcagttgcttgcagctaatgacgacttgctgagatgcagttttctttggagcaatagtcctcattgcagcagaaatccgattgtagaaagagtccattgcaggccatttcgggtccaattcaaagctcagcgggtgtggaaagagtctgttgactggcgatgatttcggaacactggtcccctttggctccgagagcaaccgatggattagtttttggacgtcacgtcgttttctggaaatagttcaggttaaagaataatacaaaattaaagctatttaccttccaacaatcatgcgatccgtctcgcacagctgttgaagccaccattgagccttcgtcaagtcggcttgacgacgaatttcctgagtattttgaattgcttgcatcctt