Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_T05F1.10   

sjj_T05F1.10RNAiJA:T05F1.10
PCR_productsjj_T05F1.10
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDST05F1.10 Source_evidenceePCR628WS150 Sequence/Annotation Release
Overlaps_Gene T05F1.10 Source_evidenceePCR628WS150 Sequence/Annotation Release
Chunk_score Abs_score502
Max_abs_score502T05F1.10
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI96476959648861
Overlaps_transcriptT05F1.10 Source_evidenceePCR628WS150 Sequence/Annotation Release
WB_DNA_textsjj_T05F1.101167agttttgcacaagcccaaagaattgtgcgaccattgcctgagctttgtatggaagaatcctgaaaataatataattttttaggactttaaataaagagcttactgaattccagcaaataccaaatagaaagctcttggagttacgagaaactcttgttccgtttcaattgcttcaaagattttctgaacaacgtaatcagtgtccagaattgggaaaatccaagggaatctaaatgaaataggtttaacagactttgaggtaaacaaggaattgttttgtagatttgactgtgatgaatagaaatggaaaaaaaatattctggaagataacatttccaaaacatcatcgaaagttttaaaacatcatagaaggttttcaaagtttttggtataactattttgaaggaaaatagagttgttttaatattgttccgttttgtcactgataaacccagaagaagctgacaattataatctttgatttctgaacattatgcattgtttgtttgaaggcatacctggtagctgctccagtggcgtcaaacatcgaagtatgaacgtaatacggacaaacaagtgttgtcttcactccatttttttcactttccattatttcagcaactaatgagtcgtgaaatccaactgctgcgtgttttgtagaagagtaatcagccttaaatataagagtttttatttacaaattctttacaaagaatttgttcaagtatgacagaacgatgccaagaaatgatactcaaacaaacaaacgataacttactagaccagaagatcccattttaccggctgctgaagcaattgtgacaatatgtccattattgtctttcagcattgctggcagaaattgttgaactgtctgtatttatttaatattttaaattataactttaaattcacttacataaaaatgtgctttcacattcacatcgaacgatctatttatctcattttcactgctatccaatatcatttttgctgaaacataaaaaaataaagattttatataattttcaatatctcgcacctgttgcaattccagcattattcaccaaaatgtcaacttttcctatatcatttattacttgttgaccaacttgtgcaatttttccggggtcacataaattaacctcataagagtgggcctggaaa