Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_T05F1.11   

sjj_T05F1.11RNAiJA:T05F1.11
PCR_productsjj_T05F1.11
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDST05F1.11 Source_evidenceePCR811WS150 Sequence/Annotation Release
Overlaps_Gene T05F1.11 Source_evidenceePCR811WS150 Sequence/Annotation Release
Chunk_score Abs_score769
Max_abs_score769T05F1.11
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI96550519655866
Overlaps_transcriptT05F1.11 Source_evidenceePCR811WS150 Sequence/Annotation Release
WB_DNA_textsjj_T05F1.11816ttcagatcagagcaacaccgggtgataaatttgataagatcccgttcttcacattctccaattcctccagaaatattggcatctgcatactcatctggtgcaagtattcggaatgttaccgtaattgaacactcacaatcagcaccaaactattttccgcatagaacgagagatgaaattaaacgagaagttcaaatggaatatgaaagaagatggagaatagaagaggaagaaagattagaagaaatacgaagaaaaaaggaagaagaaagaaaaaagaaagaagaagaggatgaaaagaggaggaaagcggaggaatcagaaagagttcgaaagttgaaggaagaagaaaaaagaaaaagggttttggaagaggagatggaaatgaaaagaaaaaatgaagaggcaaaaattaaattagaagctgaaatgagggagaaagcggaacaagctgaaattaaaaggcgtgaggaaaaatcgagagcattaaaaaaattgcaaaaagaagaaacaaacaaaatggagcagatgaacaattgtacatttctccaaaatgttcctctcttcagacatctacatccatcaggatcatattctgaacgaatgctcgatggaaaggttattggattgtattattccggttattggtgtcaaccatctcgtgactttacaccaattctcgcacaattctatagtcaagtagataagaatttcgagatattatttatttcaagcgacaggagtgaacaggagatgaattattatttgcaaagttctcatggcgattggttccatttgccattcgactcaccaata