Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_T05F1.2   

sjj_T05F1.2 RNAi JA:T05F1.2
PF:GL1_1A11
PCR_productsjj_T05F1.2
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDST05F1.2 Source_evidenceePCR1023WS150 Sequence/Annotation Release
Overlaps_Gene T05F1.2 Source_evidenceePCR1023WS150 Sequence/Annotation Release
Chunk_score Abs_score939
Max_abs_score939T05F1.2
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI96231599624325
Overlaps_transcriptT05F1.2 Source_evidenceePCR1023WS150 Sequence/Annotation Release
WB_DNA_textsjj_T05F1.21167ttctctgagcaacacgatggacgatatttctgtagaaggtaaattctatgaaaattgccctttctgaaaaataagcattgcagttatatcaagaaggttgtacctgaagattggccagtccaatacccaacagctacaaacccgttccacgaggagttgggaaatcaaggatgtattcatgaaaccgctcagtatctttcccaattcatcaacattcacgacgcgaattttgtcgaaaaactagacattgatgtcaaatactggtctcagctcttctctatcgaaaagttcagacacatccgaaatctcagaatagtgcacaatgcgcctggatcaacacattggtggctgaacagaattaacacaatgcgaactattccagaagtaacaattgcgcgaaactatactggagactttgttgaggaaaaggagtatcgtagtagaagaaatgcagtcatgcaccatgaagttatgccgtacgtgattccattcgaagaacgtgagatgccgaattgggtagagaagacttcgtattgcaattatccggtaagatatttttaaaatattatgccgatttaaataaaacatcgtattttcagatcttctgggcgaaacgaatcatctttgagaatactattgagaaccctcttaccgatttggcaagaatgagctcgttggctgaggtcaacttaaaccgttatattcttccgaattcggaacttctcgaatttctccaaatgtggtcaaacggacagatgggtcaccgtctgcggagtgtcactatcaatctcgattgcccgttatcaaagagcgaaccgattttgaatggtctccaatattcgaagacaagcgatattgagttgtgaggaatcagttctttgtggcagttttgattattcttaattcagatcgtctccgcttacgaaggctgttgaaaagaacaactatatttcgtacgttctatatcgtgagtggaaagtgttgcgtcccgatggcctgcaatcgacacgtggttttcaaaaagaatctctttcgtctgggtatggaagctctcttcctggttccggaccttcgactcctccatcggaatcaaatatagaagaagcaggagttactccgacgaacgccgaatccaaaaacatgtcctcagggcagcacagtaaacaa