Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_T05F1.6   

sjj_T05F1.6 RNAi (5)
PCR_productsjj_T05F1.6
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDST05F1.6 Source_evidenceePCR1130WS150 Sequence/Annotation Release
Overlaps_Gene T05F1.6 Source_evidenceePCR1130WS150 Sequence/Annotation Release
Chunk_score Abs_score1103
Max_abs_score1103T05F1.6
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI96272109628386
Overlaps_transcriptT05F1.6 Source_evidenceePCR1130WS150 Sequence/Annotation Release
WB_DNA_textsjj_T05F1.61177aaccagagaatgaggacgatacagaggaacccgaaaatgaggttgaagtagaaagtccagtgaaagagcaagcagatagtggtgaacctattgagaatgttaatgatgacaaggcgtctgaaccaggcgttggtgagatttcacaagacagtgttgatgattctcaaaaaattggtctcgattcaaaatcgccagatggagaatcagaagcaaatgaagagaaccaagaatctcaatcttctagccgcagcactcgtcgcgctaaaagagtttcagcaactgtttcgtctactccttcgtcaaacactccacgccgtggtggtcgtgggcaaaaatcggaagtgaatgcagatgaaacgaaaacgcccattgttagtaacagcacccccaggcgtggtcgatcttccaggggtggagacagagatgaagtaattgatcctacggagaatgttgttggcgactctggcgttgaagaaacatcaccgcgcaagggaagatcaagacgctctgttgcaacagaagacacatctgtcaccgaggaagttgaaaacacggaacatccaactgaagaagaaactccgaaacaggggcgtggaagacgttcagctgcatcttcttcagcaacttcgtctgcagtgccaacaccgcggtccacaagaggaagaggaagaaagtcgcaagcaaatgaggaaaacttgcaagaaaaagaaaccgaagaccctacaaaaactcacgatacaaaccaagcgaagtccacccgaactccgcgaggaaggcgttctaatgctgatgctgaaactatggaaagtgtagaagctgagaaagtcgaaactccaacatcatctcgtagatctacaagggctaagcctcctgcaaaatctgctccggtgacgccggctgtgacaaataaacgaacgacagttcgtggaagaaagaagcaaggttctatcacagaagaccctatcgaagaagctgatgagactattgaagaaactctaccacaaaagaaaggtcgtggagcagctaaaagtgcgccttcatcgagcaagaaaagtgcagaatatgatccatatgatcttgatactgaaatggagcatcatccagaacctttgaagaatattcacgtgagaattaaaaattaatgtttatctgtaattttgcttgttttcagatggaa